Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
 
The time now is Mon Nov 11, 2024 11:36 pm
All times are UTC - 4 (DST in action)
View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: General » ARG: Another Contest Worth Entering
[ACWE][Trailhead] AnotherContestWorthEntering
View previous topicView next topic
Page 14 of 15 [222 Posts]   Goto page: Previous 1, 2, 3, ..., 12, 13, 14, 15  Next
Author Message
Kender
Decorated


Joined: 09 Aug 2004
Posts: 264
Location: The Netherlands

Jack Trevor to me:
Quote:
As you may have noticed, my hints have been less and less informative. Due to recent events, I have felt the need to let the solves of my puzzles be done through your actions, rather than some of mine.

The beauty of puzzles is that anyone can solve them, with a little knowledge. Some people look at Sudoku puzzles and then walk away with a slight pain in their heads from thinking too much. However, teach them how to look at them logically and soon they are on-line spending hours on end doing them.

I know that this does not help you, unless you read this as it is meant to be read. Remember, sometimes saying nothing says a lot.

hmmm..

PostPosted: Wed Jan 11, 2006 8:24 am
 View user's profile Visit poster's website
 Back to top 
Whalewashingdolphin
Decorated


Joined: 25 Aug 2005
Posts: 153
Location: Canada

Jack sent this e-mail to me, after I e-mailed him:

Quote:
The following is an announcement: All of the puzzles so far have been leading up to this point. You may have noticed that my help has been less and less informative. This is because I have been trying to get less and less involved.

As I have mentioned before, when the contest ends and you have found me in my new place, you will be given everything that I have to offer you. I will be in my new place if you need me, but will not be able to offer too much information because the answers may be things that I will know nothing about. I will simply be your inside person - your "back-up". I will do my part to try and find things out for you if you need it.

It is about time that I let you try to figure this one out on your own. The forum will be up soon so you will have a place to meet the others who have contacted me and you will be able to discuss this, as well as the 40+ puzzles that will be sent out as soon as the contest ends. And believe me when I tell you that those 40+ are not as easy as I have made these ones so far.

I will admit that the current one has more involved, but once you find the key you should have no problem solving it.

LAX

_________________
Investigating: LETHEMAHLAH

PostPosted: Wed Jan 11, 2006 9:43 am
 View user's profile Visit poster's website
 Back to top 
terminalskeptik
Unfettered


Joined: 05 Jun 2003
Posts: 351
Location: Onboard the Groovy Purple Derigible

I asked about the reference to Sudoku, if it was a hint or not. Here is the reply;

Quote:
It was some of both, actually. Most will look at the puzzle and think of things to research, or try to find something hidden within the picture. These are the people that have some knowledge of puzzles. Those that don't will look at it and try some other things, and may even find something that way.

There are certain "steps" that need to be taken to solve this puzzle. And by "steps" I mean that there will be things that will be noticed along the way to solving it, both by those with the knowledge and those without.

Even those without the knowledge will be able to contribute to it's eventual completion.

LAX

_________________
www.beforethemusicdies.com

PostPosted: Wed Jan 11, 2006 5:30 pm
 View user's profile Visit poster's website AIM Address
 Back to top 
Kender
Decorated


Joined: 09 Aug 2004
Posts: 264
Location: The Netherlands

No idea on a solve yet.

Just a reminder to all that we also hang out in #acwe on the irc.chat-solutions.org IRC server.

It often helps to bounce ideas around together in there to solve a puzzle.

PostPosted: Wed Jan 11, 2006 5:39 pm
 View user's profile Visit poster's website
 Back to top 
Chewy
Decorated

Joined: 27 Sep 2005
Posts: 236
Location: In the ass-groove of the Couch

Total Spec and Possible Trouting Follows:

98% likely not to be anything important, but it seems all who register on the ACWE forums are experiencing an error with registration. The 2% part of me thinks this might be intentional. Here's the error, maybe it could help with the solve. Again, likely nothing, but no harm in posting it.

Quote:
Failed sending email :: PHP ::

DEBUG MODE

Line : 234
File : emailer.php

Probably a mistake in the coding, but hey, worth the thought. PHPbb I believe comes with a working email system in place, so either this was editted in some way by the PM or possibly a server error on the part of the boards.

Commence trouting!
_________________
Currently Playing:
Zilch.
Currently Lurking:
Nothing!

Gamertag: FriedOstrich


PostPosted: Wed Jan 11, 2006 5:54 pm
 View user's profile MSN Messenger
 Back to top 
pegasus
Greenhorn


Joined: 09 Jan 2006
Posts: 9
Location: Allentown PA

Jack is not the only one having a problem with phpbb's email system.

http://www.phpbb.com/kb/article.php?article_id=325

If he's reading this, maybe it'll be fixed soon....

EDIT: Removed evil session id.

PostPosted: Wed Jan 11, 2006 6:36 pm
 View user's profile Visit poster's website AIM Address MSN Messenger
 ICQ Number 
 Back to top 
pegasus
Greenhorn


Joined: 09 Jan 2006
Posts: 9
Location: Allentown PA

So I was sitting there mulling over the sudoku reference Jack made in his email to Kender, and I thought about websudoku.com. I mentioned to KSG that if I had a number to go on, I could pull some puzzles and see if they're somehow related. KSG then pointed out that i actually had a number: 004551. It then occurred to me that I another number: 0827. And if you want to be a real pedant about it, also 08 and 27.

With this in hand, I went and pulled some puzzles off the aforementioned page, transcribed them to cut/paste-able format, and, in order to not pollute this thread with possibly unrelated data, posted them here:

http://anothercontestworthentering.com/contestforum/viewtopic.php?p=22

I'm too tired to work on them, though, and I'll do 08 and 27 tomorrow, but I figured someone might like to poke at them, maybe. So there they are.

PostPosted: Thu Jan 12, 2006 7:03 am
 View user's profile Visit poster's website AIM Address MSN Messenger
 ICQ Number 
 Back to top 
Chewy
Decorated

Joined: 27 Sep 2005
Posts: 236
Location: In the ass-groove of the Couch

Correspondance owns.

Me To Jack:
Quote:


Noticed the "whipple", and what I can only assume is important code underneath (but no rotting, basing, vigenering or general knowledge has cracked yet).



Jack to me:
Quote:
"(but no rotting, basing, vigenering or general knowledge has cracked yet)."

Are you sure?


Unfortunately I'm done for the day, but here's some links for any of those willing and abled.

The assumption is the code at the bottom will be decyphered, and possibly again decyphered by something to do with the picture.

ROT- http://www.unfiction.com/resource/rot-it

BASE 64- http://makcoder.sourceforge.net/demo/base64.php
(May like to try other Bases)

Vigenere- http://www.dtek.chalmers.se/~d97roli/project/krypto/

Have fun!
_________________
Currently Playing:
Zilch.
Currently Lurking:
Nothing!

Gamertag: FriedOstrich


PostPosted: Thu Jan 12, 2006 11:45 pm
 View user's profile MSN Messenger
 Back to top 
smibbo
Boot

Joined: 04 Jan 2006
Posts: 46

one of the basis for decyphering is having some idea of which direction to go in, otherwise you are just using brute force.

If we are to decypher this using more than one approach in some combination, we have to have some kind of clue as to the 1+ methods to try because there seems to be an near-infinite number of combinations to try.

25 ROTs
?? Bases
26*42 Vigenere keywords

I, for one, am not about to sit and try every conceivable combination. Either there is a clue as to which direction to go in, or it's hit-and-miss.

What say you, contestants?
_________________
"never trip up a big mission by making a little mistake"

Contestant in ACWE


PostPosted: Fri Jan 13, 2006 12:30 am
 View user's profile AIM Address Yahoo Messenger
 Back to top 
terminalskeptik
Unfettered


Joined: 05 Jun 2003
Posts: 351
Location: Onboard the Groovy Purple Derigible

From the ACWE forums page, JT tells us:

Quote:
Given what I have seen so far, some have tried some things that have appeared, at first, to not work. I can assure you that trying something and just scrolling down the list of results will not show you anything at all. However, taking a good look at the results may show you something that you did not see before. If you do not get anything from trying the whole set of letters as they appear, try splitting them up into groups. Sometimes it's easier to find things in a clean room then a cluttered one.


that said, i am working on the letters broken down in sets of 6. I get that from the 004551 file name of the picture. So far nothing stands out. Maybe groups of 3?

FYI: Jack announced an IRL event this sunday in Chicago. Check out this page
http://www.anothercontestworthentering.com/contestforum/viewtopic.php?p=35#35
_________________
www.beforethemusicdies.com

PostPosted: Fri Jan 13, 2006 11:37 am
Last edited by terminalskeptik on Fri Jan 13, 2006 11:45 am; edited 1 time in total
 View user's profile Visit poster's website AIM Address
 Back to top 
smibbo
Boot

Joined: 04 Jan 2006
Posts: 46

yes, based on what he said in the forums, I did a second look and posted some observations. The direction I took might be a lead, might be a big time-sink.
_________________
"never trip up a big mission by making a little mistake"

Contestant in ACWE


PostPosted: Fri Jan 13, 2006 11:39 am
 View user's profile AIM Address Yahoo Messenger
 Back to top 
Chewy
Decorated

Joined: 27 Sep 2005
Posts: 236
Location: In the ass-groove of the Couch

ACWE has been moved to 'ARGs with Potential!'

Let's make use of our newfound potentiality. For all new puzzles, metas, interactions, etc., we can create a new thread to hold our thoughts!

Refresher:

Always tag with [ACWE] when creating a new thread.
Tag with the word [PUZZLE] when discussing a new puzzle (for example, in theory a new thread could be created for the yet unsolved Whipplei puzzle, likely titled:
[ACWE][PUZZLE] Trophryma Whipplei
[META] Tags used for Meta questions/suggestions.

And because of the high amount of email interaction, I do not suggest a new thread for every email. Perhaps a daily interaction thread, or weekly interaction thread should be used.

EXAMPLE:

[ACWE][EMAIL] 1/14/06 Interactions
or
[ACWE][EMAIL] 1/8/06-1/14/06 Interactions

Again, Woohoo for Potential!
_________________
Currently Playing:
Zilch.
Currently Lurking:
Nothing!

Gamertag: FriedOstrich


PostPosted: Sat Jan 14, 2006 6:38 pm
 View user's profile MSN Messenger
 Back to top 
Kender
Decorated


Joined: 09 Aug 2004
Posts: 264
Location: The Netherlands

Phew, finally broke the FIBB.. code:

Spoiler (Rollover to View):
YOU ARE VERY CLOSE TO SOLVING HHIS PUZZLE ROT THE FOLLOWING USING KEY NINE AND YOU WILL HAVE THE ANSWEX


No idea what the solve means though Smile

How I did it:
Code:

I applied Jacks clue to the letters a,c,g,t to get
a =  1 -> (26 - 1) = 25 = y
c =  3 -> (26 - 3) = 23 = w
g =  7 -> (26 - 7) = 19 = s
t = 20 -> (26 - 20) =  6 = f

Then I realized that that would lead to z = 26 -> (26 - 26) = 0 = XXXX so I added 1 to each letter to get:
a -> z
c -> x
g -> t
t -> g

I then applied this to the first 84 characters of Tropheryma Whippleii's genome
(gtgaacaaaaccctaaatccacaggaagtctggataaaggctgtccgaaacttagaaggttttttctcttcccctcgtgtaata) to get tgtzzxzzzzxxxgzzzgxxzxzttzztgxgttzgzzzttxgtgxxtzzzxggztzzttggggggxgxggxxxxgxtgtgzzgz
I used this as a key to vigenere decode the FIBB.. text and got nothing.
To get back to the original text I clicked 'Encrypt', but did it twice accidentally and lo and behold: a readable text.
I'm sure there is a much simpler way to solve it, but I'm too relieved to think about that right now :)


*EDIT: simpler way:
Take the genetic code, ROT-1 (increase every letter by one) and use the result to vigenere decrypt the message.

PostPosted: Sat Jan 14, 2006 7:32 pm
Last edited by Kender on Sat Jan 14, 2006 7:59 pm; edited 2 times in total
 View user's profile Visit poster's website
 Back to top 
smibbo
Boot

Joined: 04 Jan 2006
Posts: 46

dying to know how you broke it...

ROT the following? What following? did you only solve the first line? maybe there's another puzzle to come?

eh?
_________________
"never trip up a big mission by making a little mistake"

Contestant in ACWE


PostPosted: Sat Jan 14, 2006 7:55 pm
 View user's profile AIM Address Yahoo Messenger
 Back to top 
Kender
Decorated


Joined: 09 Aug 2004
Posts: 264
Location: The Netherlands

Got the next bit as well:

Spoiler (Rollover to View):
ROT-9 "thefollowing" to get cqnoxuuxfrwp, and voila: http://anothercontestworthentering.com/cqnoxuuxfrwp


Not sure if Jacks forum is a good place to post. I prefer to keep using UF.
No sense in posting everything twice.

PostPosted: Sat Jan 14, 2006 8:29 pm
 View user's profile Visit poster's website
 Back to top 
Display posts from previous:   Sort by:   
Page 14 of 15 [222 Posts]   Goto page: Previous 1, 2, 3, ..., 12, 13, 14, 15  Next
View previous topicView next topic
 Forum index » Archive » Archive: General » ARG: Another Contest Worth Entering
Jump to:  

You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group