unforum

danbullerman · Boot Joined: 22 Jan 2007 Posts: 10

New Email

**Posted:** Wed Jan 31, 2007 12:46 pm

degravedi

%2E is a period btw

**Posted:** Wed Jan 31, 2007 1:25 pm

Wabonan · Entrenched Joined: 24 Sep 2006 Posts: 1185

That DNA sight is legit. It was registered in the 1990s. so it is not ingame.
EDIT
OK I sent that Marvin guy this

**Posted:** Wed Jan 31, 2007 2:40 pm

AprilAWZ · Veteran Joined: 23 Jan 2007 Posts: 115

Jared posted a new chapter on his FicPress page. It was pretty intersting all around, but what really stuck out to me was his mention of BeastKiller. I don't know about anyone else, but except for here and in IM's that didn't include Jared, I don't believe I've mentioned BK. I'll have to go back and double check, but I'm pretty sure that BK has not come up in any conversations between Jared and I.

I know there is the small possibility of a goof up on the PM's part in bringing some aspect of these discussions into the game, but I really doubt it.

Judging by the email Dan got from ?? and Jared's comments about BK, it seems the Org/Mibs and Jared are on the same page about BK...He/she/it is up to no good. However, it seems pretty clear to me that BK has been contacting me at great personal risk, and has a very healthy fear of the powers-that-be in Black River...I'm inclined to see BK as the real deal. Soooo.... with that in mind (and barring the fact that someone else may have been filling Jared in on BK's messages to me), I'm starting to wonder if there is more to Jared than would apear... Shifty Eyes

We did see him, briefly, on AIM yesterday. I told him about this on his FicPress forum. I also asked him about his knowlege of BK

About BK's message from yesterday..."they are using me"...there's no way that could be coming from the beast itself, is there?? Because when you think about it, the Org/Mibs have made it pretty clear that they control the beast. But anyway, just throwing that idea out there.

I also got a response from Marvin. It took a while, but it was basically the same..."I don't know anything....ok?" He did say that he'd be willing to work with me, so I took him up on that in my response. I can't help but to think if I'd not been calling him "Martin" (let alone, "Creepy Marty...although he kinda is!) the whole time, maybe I'd have gotten a quicker response? Embarassed

Oh well!

Wabonan, you are too damn funny!! Well, at least now you know which of his buttons to push!! Laughing

Oh yeah....thanks for fixing that up, Degravity. I was doing 20 things at the same time when I posted that, and didn't take the time to clean it. Wink

**Posted:** Wed Jan 31, 2007 3:14 pm

arbolita

Just read up on all this...seems really interesting! Once I get home from work, I'll check out all the pages and call the number so I can start helping =)

**Posted:** Wed Jan 31, 2007 5:01 pm

ALISDAIRPARK

marvin is really Mr Garrison..Ok?...

**Posted:** Wed Jan 31, 2007 5:14 pm

_________________
Absorb what is useful <> Reject what is not <> Add what is uniquely your own
Playing : http://cerebrumachine.com and http://www.westunfictionopia.info

My charity page: http://www.justgiving.com/alisdairpark3

AprilAWZ · Veteran Joined: 23 Jan 2007 Posts: 115

ZoneandonlyBEN · Boot Joined: 23 Jan 2007 Posts: 32

ok i've been looking around this site and i found a user named PokeKiller2k6. that seems a lot like BeastKiller2k7 to me...

Plus, all these references to not being able to kill the beast (i got a phone call the other night that said that) and people telling us not to trust BeastKiller... it really seems like the PM is trying to warn us about a gamejacker.

Especially that email from the org. "It could not be killed in 2k5 and it cannot be killed in 2k7," or whatever it said. How much more explicit can they be? BeastKiller=gamejacker. I think, anyway.

So... you guys can waste your time if you want but i really think we should just ignore bk.

-----

anyway, anyone else think it's interesting that none of us heard anything from anyone at all yesterday, and then today we find that black river dropped out of time for a while?

So, who's pumped for this second task? And who else is worried about whatever payment we're supposed to send Marvin?

And oh yeah. Let's start taking advantage of this ARGs With Potential thing, and start posting new info in its own threads.

(see? i've been doing my homework on this site! Smile

)

just my $.02.

**Posted:** Wed Jan 31, 2007 6:15 pm

ZoneandonlyBEN · Boot Joined: 23 Jan 2007 Posts: 32

**Posted:** Wed Jan 31, 2007 6:17 pm

AprilAWZ · Veteran Joined: 23 Jan 2007 Posts: 115

That is a definite possibility, but if that's the case, then this arg is looking pretty dull... Almost all of our correspondances have been fruitless. There are no websites or other sources that any of us have found that would let us dig deeper into the story....We've basically been sitting around waiting for quizzes.

What did you find out about Pokekiller?

**Posted:** Wed Jan 31, 2007 7:30 pm

AprilAWZ · Veteran Joined: 23 Jan 2007 Posts: 115

New BK...take it or leave it!

Beastkiller2k7 (5:44:44 PM): 0100000101101001011011010110010101100101001000000100110101
1000010110111001101110 %73%61%79%73%00 151164040142145163164
Beastkiller2k7 (5:44:51 PM): zweimal

CTCATACTCCTCATAATACAAATAAGGCAAATACAACAACTCCAACTCCTCC
AAAGGAGGAGGAGGCAAATA
Beastkiller2k7 signed off at 5:44:34 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.

Wabonan · Entrenched Joined: 24 Sep 2006 Posts: 1185

Ok another reply from Marvin

**Posted:** Wed Jan 31, 2007 8:13 pm

arbolita

**Posted:** Wed Jan 31, 2007 8:34 pm