Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
  

The time now is Fri Nov 15, 2024 11:58 pm
All times are UTC - 4 (DST in action)		 View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: General » Low-Volume Games
[BBR][TRAILHEAD] The Beast of Black River
View previous topicView next topic
Page 7 of 10 [137 Posts]   Goto page: Previous 1, 2, 3, 4, 5, 6, 7, 8, 9, 10  Next
Author Message
tipsila
Unfettered


Joined: 10 Apr 2006
Posts: 545
Location: In the back of your mind
AprilAWZ wrote:
"Seculum" would translate into "to cut"...

eta - Dan and I were talking, and we came up with a thought. If you look at "seculumnarvartis", you can translate a portion of it from latin to english. "Seculum" mean "to cut". We've not been able to find a translation for "narvartis" or any other fragment from that word.

If you look at the background latin "gibberish" from the movie site, I wonder if there isn't a possibility that we have to cut either the non-word "narvartis", or just the letters that make up the word from the latin background text from the movie site in order to come up with ???


Not sure what it means, but here's what I found for seculum nar vatis
From Charlton T. Lewis, Charles Short, A Latin Dictionary

Quote:
sēcŭlum , v. saeculum.

saecŭlum (poet., esp. Lucretian, sae-clum ; less correctly sēcŭlum, sē-clum ), i, n. dim. [etym. dub.; perh. root si- = sa-; Gr. saô, to sift; Lat. sero, satus; whence Saturnus, etc.; hence, orig.] ,

I. a race, breed, generation (freq. in Lucr.; very rare in later writers; usu. in plur.)
1. The ordinary lifetime of the human species, a lifetime, generation, age
2. The human race living in a particular age, a generation, an age, the times
3. The spirit of the age or times


Nar , Nartis; only plur., Nartes , ium, m.,

I. dwellers on the banks of the Nar: Interamnates, cognomine Nartes, Plin. 3 , 14, 19, § 113; gen.: Interamnatium Nartium, Inscr. Grut. 407, 1 .

vātes (vātis , Cic. Div. 2, 5, 12 Christ.)

I. gen. plur. vatium, id. Leg. 2, 8, 20 al.), comm. [perh. kindr. with Sanscr. vad, dicere, loqui; cf.: vas, vadis, and old Irish, fáith] , a foreteller, seer, soothsayer, prophet.


PostPosted: Sat Jan 27, 2007 3:23 am
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115

 		Nice find! Very Happy I was just using a basic translator - this definitely fits with the story line much more that what I was trying to piece together!

I just hope it's right because I sent off the answers earlier...crossing my fingers!

PostPosted: Sat Jan 27, 2007 3:50 am
 View user's profile AIM Address
 ICQ Number 
 Back to top 
danbullerman
Boot

Joined: 22 Jan 2007
Posts: 10

 		update
update on christinas log and on jared story page. Jared sent in the answers and used the code word we supplied. just waiting now.

PostPosted: Sat Jan 27, 2007 4:37 pm
 View user's profile
 Back to top 
danbullerman
Boot

Joined: 22 Jan 2007
Posts: 10

 		[updated] http://www.fictionpress.com/~jmathison
Well, we figured out all the questions and the task is complete. His website is updated and his mother is back. Now we wait for task 2.

PostPosted: Sat Jan 27, 2007 10:40 pm
 View user's profile
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115

 		I have a feeling that Beastkiller is Jared's mother, Maria. If you go back and look at the AIM conversation, and then the following encrypted message, it does seem to follow the story.

I left a message on the forum at Jared's ficpress page. I figured that might be a good IG place to use if AIM is problematic.

Way to go team!! One down.... Wink

PostPosted: Sun Jan 28, 2007 1:19 am
Last edited by AprilAWZ on Sun Jan 28, 2007 1:30 am; edited 1 time in total
 View user's profile AIM Address
 ICQ Number 
 Back to top 
AngBa
Unfettered


Joined: 10 Apr 2006
Posts: 532
Location: the pit of misery, KS

 		I'm glad that Jared's mom is safe - and for what it's worth, I have received a few calls over the last couple of days. They're always from 'Restricted' numbers - and the last one was around 3:30am CST. They've always called when I was busy at work or (see above) SLEEPING. They've never left a message, and I haven't heard from them today, but just thought I'd let everyone know that I'm getting random calls...
_________________
Played: WiBS; AV; Enoch of Gatewood
Watching/Interacting: Gabriel Lawson???

I'm only angry because I hate bananas...

PostPosted: Sun Jan 28, 2007 1:21 am
 View user's profile AIM Address Yahoo Messenger
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115
AngBa wrote:
I'm glad that Jared's mom is safe - and for what it's worth, I have received a few calls over the last couple of days. They're always from 'Restricted' numbers - and the last one was around 3:30am CST. They've always called when I was busy at work or (see above) SLEEPING. They've never left a message, and I haven't heard from them today, but just thought I'd let everyone know that I'm getting random calls...


I've only recieved one call, it was from Jared, and his name popped up. I think Stephen or Ryan said they had gotten a call that showed up as restricted, and was from someone warning him to stay away, likely mib?

Sooo, it looks like we have a few more things to add to the list of "known unknowns"

1. Who is "Beastkiller2k7/"M"? (I think it's his mom, Maria.)
2. Why did Benjy seem unconcerned that his parents were still gone the night Jared stayed with him?
3. Why were the people slumped over on their porches when Jared's Dad drove him home from Benjy's?
4. Why was the mib unwilling/unable to go down into Mrs. Bigg's basement when they attacked her in her home?
5. Did the Org capture, or create the beast?

PostPosted: Sun Jan 28, 2007 1:39 am
 View user's profile AIM Address
 ICQ Number 
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115

 		New post on Jared's ficpress - chapter 10. Details about his mom's capture, and introduces a new, rather...colorful character into the mix.
Initially, he looks like an overly-caffeinated hack, but his blog gets interesting.

http://paranormalqanda.googlepages.com/home

I'd sent out an email earlier to the teen club, the theatre, and Johnson's motel with a bland, "we're here to help" message. However, since we've been lead to believe that they are watching, the bulk of the email was actually hidden text, specifically for the Org. Basically, I wanted to poke them with a stick...we know about you, we are going to expose you, leave BR, etc.

I've only gotten one response from Nadine...thanks for your help, others have contacted us, etc. So, basically, if "they" have found it, they've not taken my taunts very seriously..lol!

PostPosted: Mon Jan 29, 2007 1:45 pm
 View user's profile AIM Address
 ICQ Number 
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115

 		ok...new message from Beastkiller. I think I just got a virtual bitch-slap for poking the org... Laughing Shocked Oh well, I was bored, and we all know that never ends well!

So, via AIM, I got this message from Beastkiller2k7:

Beastkiller2k7 (4:45:32 PM): i dont have much time
AprilFCG (4:45:08 PM): are you ok?
AprilFCG (4:45:16 PM): Are you Maria?
Beastkiller2k7 (4:46:27 PM): 0600610610610610600600610600610610600610610610610600610610
6106006106006106006006106006006006006006006106106006006006
0061060061061061060060061060060061061060060061060061060061
0610600610610
Beastkiller2k7 (4:46:32 PM): DONT SAY THAT NAME
AprilFCG (4:45:59 PM): ok,ok..
Beastkiller2k7 (4:46:51 PM): 6106006006106106106006106006006006006106006006006006006006
1061060061060060060060061061060060061060061060061061060061
0610600600600610610610600600600600600610610600610600600610
6006106106006106106106006006106106006006106106106006006106
0061061061060060060061060061061061060060060061060061061061
060060060061060061
AprilFCG (4:46:40 PM): will there be a contact person who can help us get more info?
Beastkiller2k7 (4:47:20 PM): 0610610600600610610610600610600600600610610600610600600600
60061
Beastkiller2k7 (4:47:32 PM): 0610600600610600610600600610600600600600600600610610610600
6106006006006106106006006006006106006106106106006006106106
0061061060061060061061060061061061060060061061
Beastkiller2k7 (4:47:41 PM): 0600600610600600600600600600610610610600610610610600610610
6006106106106106006106106006106106106006006106106106006106
0060060060061060060060060060060061061060061061060061060061
0610600600600600610600610610600610600610610600610610600600
6106006106006006106006006006
Beastkiller2k7 (4:47:51 PM): 0060060061061061060061060060060061061060061060060060060061
0610600600610600610600610610600610610600610600600610600600
6006006006006106106106006006106106006106106106006106006006
0061061060061061061061060061061061060060060060060060061060
06106
Beastkiller2k7 (4:48:15 PM): 1061060060060061060060060060060060060061060060060060060060
0610610610610600600610600610610600610610610610600610610610
6006106006106006006106006006006006006006106106006106106006
1060061061061060061060061060061061061060060061061060061061
0610600610600600600600610600600600600600600610610600600610
6106006006106106006106006006106006106106006106
Beastkiller2k7 (4:48:25 PM): 1061060060061061060060061060060060060061060060060060060060
0610610610600610600600600610610600610600600600600610610600
6006106006106006006106006006006006006006106106106006006006
00600610610600610610610610600610610600610600600
Beastkiller2k7 (4:48:32 PM): 6106006106106006106106106006006106106106006106006006006006
1060061061061060060060061060060060060060060060061060060060
0600600600610610600600610610600600610610600610600600610600
6106106006106106106006006106106006006106006006006006106006
0060060060060061061061060061060060060061061060061060
Beastkiller2k7 (4:48:38 PM): 0600600600610610600600610600610600600610600600600600600600
6106106106006006006006006106106006106106106106006106106006
1060060061060061061060061061061060060061061061060061060060
0600600610600600600600600600610610600610610610610600610610
6006006106106006006006106006006006006006006106106106006106
00600600610610600
Beastkiller2k7 (4:48:49 PM): 6106006006006006106106006106006006106006106106106006006106
1060060061060060060060060060061061061060060060060060061061
0600610610600600600610610600600610600610600610610600600600
6006106006106106106006006106106006106106006006106006106006
0061060060060060060060061061060061060060060060061061060060
0610600610600610610600610610600600600610610610600600600600
6006006106006106106106006006006106006106106106006006006106
006106106106006006006106006106106106
Beastkiller2k7 (4:48:57 PM): 0060060061060061061061060060060061060060060060060060061060
060061061060061
Beastkiller2k7 signed off at 4:48:21 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.
Beastkiller2k7 signed on at 5:22:15 PM.
Beastkiller2k7 signed off at 5:22:20 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.
Beastkiller2k7 signed on at 5:22:27 PM.
Beastkiller2k7 signed off at 5:22:31 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.
Beastkiller2k7 signed on at 5:23:49 PM.
AprilFCG (5:24:00 PM): Hello..
Beastkiller2k7 (5:24:49 PM): 0111010101110011011001010010000001110100011010000110010100
1000000100111101000011010101000100111101010000010101010101
0011001000000111011101101001011101000110100000100000011101
0001101000011001010010000001000010010010010100111001000100
0100111101010111
Beastkiller2k7 (5:25:05 PM): I am getting brief moments
Beastkiller2k7 (5:25:11 PM): this isnt working all the time
Beastkiller2k7 (5:25:13 PM): i must be quick
Beastkiller2k7 signed off at 5:24:33 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.
Beastkiller2k7 signed on at 5:24:35 PM.
Beastkiller2k7 signed off at 5:24:38 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.
Beastkiller2k7 signed on at 5:24:43 PM.
Beastkiller2k7 signed off at 5:24:45 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.

Dan was also IM'd with the last portion of binary code.

Spoiler (Rollover to View):
Because Dan is a decoding machine, he found the correct cyphers and the first part was decoded using 8-bit, then binary (per the hint in the binary portion of the IM) into:

you arent helping....the tasks wont make them stop. you must find the point. find the point of this please help..... M


That's where I got the idea that not only was I barking up the wrong tree, but me prodding the Org was probably not appreciated...oops! Embarassed

Spoiler (Rollover to View):
From here, we thought that this message was telling us that the key to solving the mystery was finding out why this was happening.


With that in mind, I emailed the newest character, Marty. Creepy Marty. I asked him if he might have any idea why this might be happening, and what purpose is served by basically terrorizing the town. Now, to wait for a response....

PostPosted: Mon Jan 29, 2007 9:07 pm
Last edited by AprilAWZ on Tue Jan 30, 2007 4:04 pm; edited 1 time in total
 View user's profile AIM Address
 ICQ Number 
 Back to top 
thebruce
Dances With Wikis


Joined: 16 Aug 2004
Posts: 6899
Location: Kitchener, Ontario

 		April, quick request - can you break up the long lines of numbers that are stretching the thread plz?
_________________
@4DFiction/@Wikibruce/Contact
ARGFest 2013 - Seattle! ARGFest.com

PostPosted: Tue Jan 30, 2007 2:51 pm
 View user's profile Visit poster's website AIM Address
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115
thebruce wrote:
April, quick request - can you break up the long lines of numbers that are stretching the thread plz?


Got'cha...that did look a bit rough... Shocked

PostPosted: Tue Jan 30, 2007 4:09 pm
 View user's profile AIM Address
 ICQ Number 
 Back to top 
Wabonan
Entrenched


Joined: 24 Sep 2006
Posts: 1185

 		I sent a e-mail to Marvin Kugelhoffer heres what I got
Quote:
Listen, OK? I don't know what happened, but I've been getting a ton of emails about this beast, ok? I really don't know what's going on, ok? I was just interested in the whole cryptozoology aspect of the thing but I really don't know what's happening, ok?

Trust me, if I know anything, I'll tell people. For a price. But I'm really not connected. I just emailed this Jared kid to see what he knew. And then he put me in his story, or whatever. So, if you need my help with something specific, then go ahead and email. If not... then please, don't. Ok?

Smile Thank you and have a stupendous day!

Marvin


----- Original Message ----
From: david Johnson <wabonan>
To: biggestnerdev3rSPLATyahoo.com
Sent: Tuesday, January 30, 2007 12:48:32 PM
Subject: beast of blackriver

Hi I heard you were helping with the beast of blackriver. Maybe you can help me identify the cryptid The stories say it is hairy and has a forked flat tail (maybe for swimming) the only thing is is I can't find any creatures that have hair and have a flat forked tail(fishlike). I asked jered several times in different ways so be sure. Could it be some kind of genetic mutation??..... Wabonan

I sent him a nasty reply ..lol if it comes back ill post it..lol

PostPosted: Tue Jan 30, 2007 6:28 pm
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 ICQ Number 
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115

 		Wow, that guy's really got to lay off the espresso!! Shocked lol! I can't wait to see what he has to say in repsonse...lol!!

I emailed him too, we'll see if I hear back...I'm more that a little worried about what he expects in payment...???

You know, I'm getting the feeling that we are just not asking the right questions. Judging by the response I got from "M" last night and your response from Creepy Marty, Wabonan, I'm starting to think that this is not about the beast so much as it is the mystery as to why this is happening in BR. Who is the Org, what are they doing, why in BR, etc. The Beast is just the needed obvious "bad guy", so to speak, but not necessarily the center of the story. But of course, that's just mho...I could be way off.

However, I'm not finding anything new since changing my focus...just going in circles, basically.

PostPosted: Tue Jan 30, 2007 7:12 pm
 View user's profile AIM Address
 ICQ Number 
 Back to top 
Wabonan
Entrenched


Joined: 24 Sep 2006
Posts: 1185

 		The real bad guys here are the MIB.. they somehow control the beast... Also the beast is not natural (hairy with a fish tail) so we got some peeps that are torturing blackriver for some reason. though we don't know why...also why would anyone want to mess with jared hes a kid. I would bet his parents know more than they are telling

PostPosted: Tue Jan 30, 2007 7:43 pm
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 ICQ Number 
 Back to top 
AprilAWZ
Veteran

Joined: 23 Jan 2007
Posts: 115

 		Well, I really think that Beastkiller2k7 is really starting to bond with me....

Beastkiller2k7 (8:44:18 PM): TCTGGTGGATTGTCGGGAGCGTAGTACGCTTTGTCTGCATCGGTGTTTAAC
ATGTTGGCTTAGTACTCTTTGGCGTAGTAATATGTTGGATCTGGATTGGTAT
CTTTTAACATGTTGTATGTTGGAGCATCGGGATTTAACATGTTGTCTGGTGG
ATTATTGGCATCCGGATTGTGATCGGTATACGGGTTGTAAGGATTTAACATG
TTGGTATCTTTGGGTTGATCCTCTTCGTTTAACATGTTGTTGGGATGCGGAT
CCTTATCTGTATAAGGATTGTTATAGTGATTTAACATGTTTAACATGTTTAAC
ATGTTGGTATTGGCGGCATACTCTTTGGTTGTATGCGGATTGTGGGTATCTG
GTTTGTCTGGTGTATCGTTGTATGCAGTATACTTTAACATGTTGTTGGTATTG
GCCGGAGGGTTGTTATAGTGA
Beastkiller2k7 signed off at 8:48:40 PM.
Beastkiller2k7 is offline and will receive your IMs when signing back in.

Spoiler (Rollover to View):
Dan recognized it as DNA. After having no luck with a couple of online DNA sequence calculators, BK signed on, but didn't IM either of us. Dan checked her/his/it's AIM profile, and found a link that said "Black River Virus" This link took us to http://www.attotron.com From there, I was able to find a tool for using DNA sequences as code. http://www.attotron.com/cybertory/analysis/secret.htm

Decoded, the message read:
the second task%2E dont complete it%2E please%2E they are using me%2E it hurts%2E everytime you%2E%2E%2E i cant live with this pain%2E i beg you


As this was happening, the "away" message for BK kept changing. The first was "Do you understand now?", then "Do not be afraid", and last, "Do not anger....(we think it was ATCG)..."

PostPosted: Tue Jan 30, 2007 11:53 pm
 View user's profile AIM Address
 ICQ Number 
 Back to top 
Display posts from previous:   Sort by:   
Page 7 of 10 [137 Posts]   Goto page: Previous 1, 2, 3, 4, 5, 6, 7, 8, 9, 10  Next
View previous topicView next topic
 Forum index » Archive » Archive: General » Low-Volume Games
Jump to:  


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group