Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
  

The time now is Mon Nov 18, 2024 6:53 pm
All times are UTC - 4 (DST in action)		 View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Diversions » TimeWasters
Geocaching anyone? Help me break this code, please...
Moderators: Giskard, ndemeter, ScarpeGrosse
View previous topicView next topic
Page 1 of 1 [4 Posts]  
Author Message
tbot
Kilroy

Joined: 27 Mar 2005
Posts: 1

 		Geocaching anyone? Help me break this code, please...
A friend found unfiction.com for me when I asked him for help breaking a code. Once I logged on here, I promptly forgot my code-breaking dilemma and starting researching ARGs... looks like I have yet another new hobby!

But, I'm returning to breaking the code. The site for the code is here.

If that link doesn't work, go to geocaching.com and search for "life's little instruction book", which is the name of the cache. Obviously, the key to the code has something to do with DNA; but WHAT?? I know that A always pairs with T and C with G, but how do I convert this string (see below) into a set of coordinates?

I must admit, I like geocaching, but codebreaking is definitely not one of my strengths.

Help please!

1/2 of a DNA string/thread:

"Line breaks are arbitrary, read right through:"

CGTTGTATATGCATCTTCGCAGATATTAGCTTCCACTTAGATGCAAC
AGCAATCCCCATTCAAAATTATGATGACCATGCAAGTTGCTAGGGT
AGCTTCATTTTCACGGGCGTACTCATGAGTTGACTCATGGCAAGCA
CAGTTTTCCACAATTCTGTCTTCGCAATTCTCTATACAAGATTCTTTG
ATCAAAATCAT

[edit] Added the missing linebreaks to fix wrapping problem. -bill

PostPosted: Sun Mar 27, 2005 4:44 am
 View user's profile
 Back to top 
firefox
Unfettered

Joined: 28 Jul 2004
Posts: 333

 		might it have something to do with this table
notice how you can break up that code into blocks three letters, and each possible combination has a corresponding letter. ie- GAT is D

so then we get something that looks like :
Spoiler (Rollover to View):

LCICIFADISHLDATAIPIQNYDDHASC

(TER or end)

GSFIFTGVLMS

(TER or end)

LMASTVFHNSVFAILYTRFFDQNH


i might have made some mistakes transcribing it, hey its late at night Wink

so.. hope that helps, cos i have no idea what to do from here. Razz

PostPosted: Wed Mar 30, 2005 10:10 am
 View user's profile
 Back to top 
Nik_Doof
Unfettered


Joined: 09 Oct 2004
Posts: 494
Location: Liverpool, UK

 		Its genetic sequencing, human genome project style Smile
_________________
Nik_Doof
No you cant have my 333 Letimark Very Happy

PostPosted: Wed Mar 30, 2005 6:26 pm
 View user's profile Visit poster's website AIM Address Yahoo Messenger MSN Messenger
 ICQ Number 
 Back to top 
bartmans
Veteran


Joined: 30 Dec 2004
Posts: 97
Location: the Netherlands

 		DNA indeed can encode proteins by a three-letter code. However, this also means that each DNA sequence contains three different reading frames, wherein a triplet codon can run from position 1-3, 2-4 or 3-5.
Further, as is stated before, each DNA also has a second strand which is complementary to the first strand. This complementary strand can also be coding and again with three reading frames. Thus, each DNA strand in general has six different translations.
In this case these six different translations read:

Spoiler (Rollover to View):
Translate Tool - Results of translation
Please select one of the following frames:
5'3' Frame 1
R C I C I F A D I S F H L D A T A I P I Q N Y D D H A S C Stop G S F I F T G V L Met S Stop L Met A S T V F H N S V F A I L Y T R F F D Q N H


5'3' Frame 2
V V Y A S S Q I L A S T Stop Met Q Q Q S P F K I Met Met T Met Q V A R V A S F S R A Y S Stop V D S W Q A Q F S T I L S S Q F S I Q D S L I K I

5'3' Frame 3
L Y Met H L R R Y Stop L P L R C N S N P H S K L Stop Stop P C K L L G Stop L H F H G R T H E L T H G K H S F P Q F C L R N S L Y K I L Stop S K S

3'5' Frame 1
Met I L I K E S C I E N C E D R I V E N C A C H E S T H E Y A R E N E A T L A T C Met V I I I L N G D C C C I Stop V E A N I C E D A Y T T

3'5' Frame 2
Stop F Stop S K N L V Stop R I A K T E L W K T V L A Met S Q L Met S T P V K Met K L P Stop Q L A W S S Stop F Stop Met G I A V A S K W K L I S A K Met H I Q

3'5' Frame 3
D F D Q R I L Y R E L R R Q N C G K L C L P Stop V N S Stop V R P Stop K Stop S Y P S N L H G H H N F E W G L L L H L S G S Stop Y L R R C I Y N


Thus, you see that in this case the first reading frame of the contemplary strand gives the code you want.
Apparently after the word NEAT the coordinates are given in Roman numbers, where you should read Met as being M, thus probably:
Spoiler (Rollover to View):

A T C Met V I I I L N G D C C C I Stop V E A N I C E D A Y T T =
Lat CMVIII Lng DCCCI = at 908 Lng 531 whereby I assume that the stopcodon would be abbreviated as Ha(lt), thus giving:
Have a nice day


The program for translating DNA sequences can be found at: http://au.expasy.org/tools/dna.html
_________________
Life is just like a game. You know it has to come to an end.

PostPosted: Thu Mar 31, 2005 4:23 am
 View user's profile
 Back to top 
Display posts from previous:   Sort by:   
Page 1 of 1 [4 Posts]  
View previous topicView next topic
 Forum index » Diversions » TimeWasters
Jump to:  


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group