Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
  

The time now is Wed Nov 13, 2024 4:10 pm
All times are UTC - 4 (DST in action)		 View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: General » ARG: Regenesis
[UPDATE] Login for NorBAC
View previous topicView next topic
Page 1 of 1 [8 Posts]  
Author Message
Buck Rodgers12
Veteran

Joined: 27 Sep 2004
Posts: 124
Location: Los Angeles

 		[UPDATE] Login for NorBAC
this the way to get into the remote NorBAC desktop

Spoiler (Rollover to View):
Type in your field code and give the password carbon


There is some stuff we should look at.
_________________
Pandora Next!

Media Team Member: The Architect

Mission Statement: TBA

PostPosted: Mon Nov 15, 2004 12:16 am
 View user's profile AIM Address Yahoo Messenger
 Back to top 
agent orange
Kilroy

Joined: 06 Nov 2004
Posts: 1

 		norbac website access
to obtain access to the norbac website type in your agent code and the password is 'carbon'

PostPosted: Mon Nov 15, 2004 12:17 am
 View user's profile
 Back to top 
robbie6996
Greenhorn

Joined: 15 Nov 2004
Posts: 3

 		norbac website!
i just took a look at the website!! its got alot of interesting information on it.. if you click on the medicine bottle thing in the bottom right, it will open up a trash can folder... two of the letters that Agent Ock picked up a while ago were in there. As well an outtake i guess of the field agent status video is in there. Under the tools option on the right i downloaded the DNA Sequencer. I ran the program and it came up with the DNA sequence of ACAGGCGAGCCGGACTCTGG

im not sure if that sequence means anything. but that is all the program does. In the top corner it says "Source. Potential . Martin Jamison" and upon reading some of the notes i came across that name. i guess i didnt remember it from the show. Martin Jamison is who they suspected to be the person causing the Miranda Virus. His other name is William Zanzinger.

In the file browser under misc. you can take a look at the surveillance camera from the gas station where the miranda virus first spread. you guys go take a look tell me if anything else is interesting or important. The security camera is inaccessable. Anyways that was my findings of the website

PostPosted: Mon Nov 15, 2004 1:12 am
 View user's profile
 Back to top 
jenni42ld
Decorated

Joined: 20 Sep 2004
Posts: 207
Location: Austin, TX

 		Just wondering where you learned this... havent gotten to see next ep yet.

PostPosted: Mon Nov 15, 2004 1:29 am
 View user's profile AIM Address
 Back to top 
robbie6996
Greenhorn

Joined: 15 Nov 2004
Posts: 3

 		learned what?

PostPosted: Mon Nov 15, 2004 2:30 am
 View user's profile
 Back to top 
trallyus
Boot

Joined: 18 Oct 2002
Posts: 48
robbie6996 wrote:
learned what?


I think they want to know how the person learned the password was carbon for norbac as I am in the U.S. and so far no one explained how they found the password for the site Smile

Also I think Bob at norbac needs 400 DNA sequences before the story is advanced as I sent him 4 DNA sequences and got the following email -

Quote:
Thanks, but I'm able to get sequences of 20 using the automatic sequencer as well. What I really don't have time for right now is the full sequence of 400.

I'm afraid I have my mind on other things right now. It's so great to have you to help.

Bob.



Over on the sciencesucks board is a list of 62 DNA sequences we pulled together so far. I hope more people over there start adding to the list so we can get all 400 faster.

To get more then one sequence requires a person to run that DNA sequencer from the norbac site, then type the sequence to notepad and right click the sequencer and choose rewind and start all over again Smile

Trallyus

PostPosted: Mon Nov 15, 2004 9:14 am
 View user's profile
 Back to top 
robbie6996
Greenhorn

Joined: 15 Nov 2004
Posts: 3

 		the way they password was learned for the intranet on norbac.ca... was during the episode... mayko is being shown the connections between the 4 victims of the prion disease... and she goes to access the computer and sayd .. "did you change the intranet password again??" and she is told it is carbon... something very subtle but it was caught onto

PostPosted: Mon Nov 15, 2004 5:55 pm
 View user's profile
 Back to top 
whiterabbit83
Greenhorn

Joined: 28 Oct 2004
Posts: 3
Location: London

 		Here is the code for the string of 400 send this in an email to Bob
melnikovSPLATnorbac.ca
AGAAGCTCAGGCGGCATTTCAGTATTCGAACGCATAATGTATTCCTGCGCTCG
GTACAGTTGATCCTACATAGATATGAGATGACTTGTCTGCACTGATCGCACAG
GCGAGCCGGACTCTGGTCAGAGATCGAGTCATGTTGGCTGAAAAATGATTTT
AATCATCCGTCGGATTGTTTTCCTTGCAAGGTACGAAACGGAGCGCTGCCCT
GTACGACGTCTGGTAGGTCCTCCTGAGAATTTTCCTGTAAAACCCGAACTCC
TGCAGGATGACTAAACGGCAAGCAGGCTACATTTAGATCGTATGAAATAGCT
TCTTCGCAGGGAATACGAGCGACGACAACTTCACTAGCCACAAGTTCCGTCT
TCGCGCTTCTAGACATCACGTAATTATTCACCAT

Want to thank Leyf from sciencesucks.com who put all the peices togeather!!! But good from everyone involved!!!!!!

[EDITED text string to fit better -vpi]

PostPosted: Wed Nov 17, 2004 12:23 pm
 View user's profile MSN Messenger
 Back to top 
Display posts from previous:   Sort by:   
Page 1 of 1 [8 Posts]  
View previous topicView next topic
 Forum index » Archive » Archive: General » ARG: Regenesis
Jump to:  


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group