unforum

[somerswey]

FEARLESS and GOOD

[Agent Lex]

Re: FEARLESS and GOOD

[somerswey]

Never underestimate the power of not being able to spell.

Looks like bold/fearless/good is a better fit.

[Agent Lex]

Mr Darley, as a web designer I'm surprised you can't see where "bold" came from. I only just got it myself, to be sure.

E and M were indeed highlighted and made bold in Flying. But also, <em> is the replacement html tag for <b>, aka bold. And in "FEMARLEMSSGQQD" both Es are followed by M, making "EM" twice.

D'oh.

[Rand0m]

[rose]

So I googled stong, good (yeah, I'm not smart enough to see GQQD and assumed GOOD -but next time I would) and bold and found the Dukes of Burgandy, but I just don't know if I would have taken the extra step to find the butterflies. I doubt it. I think I would have been put off because I know Burgandy is in France and I would have thought it was taking me away from England.

This is really a long way from the number strings I think. Very complicated puzzle.

[sixsidedsquare]

Wow, I agree rose, this is a long way from the number strings. Looking at doing it without the LoB hints, I'm not sure how it could be done, unless there were more hints on the cards that completely passed us by. The problem is just that there are so many dead steps on the way that give no indication that you are on the right track.

First of all you start with the number strings, which you might be able to match to the map with the corners of key square if you look hard enough (if you ignore the 2 bits that didn't quite work out). I even tried to do this for a few hours but got disheartened by not even being able to tell if 1=up and coming to lots of random sequences of letters.

Then you had to use the last number of the strings to get the letter from the street and index this list of letters with first numbers of the strings (going 1-2-3-4-1-2- etc) and even shuffle these around a bit to get the right order. And what did that give you? "FRBPULAFHPOSMLUCNIDYMENDBKIELGTPDOAAKILTIO ", a random string of letters.

Next you had to do the whole mod 4 thing to this string, using the 4 specific RNA letters in the right order (Which the cards must have had a hint to somewhere, surely) and this "UUUGAGAUGGCCAGACUAGAAAUGUCAAGCGGGCAACAGGAC " a list of random letters, albeit with somewhat less variation. Of course this string could be interpreted as the smaller RNA equivalent giving the "FEMARLEMSSGQQD". And still here there isn't anything outright obvious, you still needed to pick out the 'EM' codes and see that Q's are used for O's, and then google your result.

This was probably the biggest cube finding hint and I guess they couldn't make it easy sure, but looking at it apart from the LoB stuff there had to be some indication of what to do on other cards right? You can't expect someone to rot the vig of a Beale without some sort of instructions or indication they are on the right track. If I gave you "MDEIUGAETOSTYEHSRLOOD" I don't imagine you could tell that you were supposed to convert it to morse with consonants being dots and vowels being dashes, split it up correctly to get letters then take the corresponding letters from the first sentence of this post ala "a=1 - z=26" to find an answer.

Gee I sound to be rambling a bit now, all I'm trying to say is there must have been hints right?

[krystyn]

Excellently-written story, rand0m.

Congratulations to you!

[Scribe]

I second what sixsidedsquare said (+ nice summary there - I'm guessing the second joker card had some kind of big clue that we missed, at least.

[levicc00123]

Re: Puzzle solutions????

[ne0x]

[ginc]

Re: Puzzle solutions????

[sixsidedsquare]

[rose]

[makomk]