Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
 
The time now is Wed Nov 20, 2024 4:10 am
All times are UTC - 4 (DST in action)
View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: General » Low-Volume Games
[GC] The Genesis Code Trailhead: Triad Genomics
View previous topicView next topic
Page 13 of 37 [546 Posts]   Goto page: Previous 1, 2, 3, ..., 11, 12, 13, 14, 15, ..., 35, 36, 37  Next
Author Message
argman90
Boot

Joined: 03 Jul 2007
Posts: 13

Dr. Ambergris' reply to my inquiry about his concern with the men in black:

Quote:
The men in black are everywhere. The Order is ancient and its members and acolytes guard the secrets of Order secrets through a conspiracy of silence and murder. Beware the men in black.


PostPosted: Thu Jul 05, 2007 5:10 pm
 View user's profile
 Back to top 
ALISDAIRPARK
Unfictologist


Joined: 27 Nov 2005
Posts: 1646
Location: Everywhere else

thedude07 wrote:
there is also a piccture that leads to this: BINYYEGEO... etc.


EDIT: Untrouting my trouty comment as you has already detrouted your troutiness a few posts later.

BTW: Haven't spotted a solve for this one yet though...
_________________
Absorb what is useful <> Reject what is not <> Add what is uniquely your own
Playing : http://cerebrumachine.com and http://www.westunfictionopia.info

My charity page: http://www.justgiving.com/alisdairpark3


PostPosted: Thu Jul 05, 2007 5:30 pm
 View user's profile
 Back to top 
tipsila
Unfettered


Joined: 10 Apr 2006
Posts: 545
Location: In the back of your mind

ALISDAIRPARK wrote:
thedude07 wrote:
there is also a piccture that leads to this: BINYYEGEO... etc.


EDIT: Untrouting my trouty comment as you has already detrouted your troutiness a few posts later.

BTW: Haven't spotted a solve for this one yet though...


Is this the one?

PostPosted: Thu Jul 05, 2007 5:43 pm
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 Back to top 
James Stone
Decorated


Joined: 30 Sep 2006
Posts: 174
Location: England

Fish supper for everyone Trout Trout Trout Trout Trout Trout


Now.
Quote:

there is also a piccture that leads to this: BINYYEGEO... etc.


EDIT: Untrouting my trouty comment as you has already detrouted your troutiness a few posts later.

BTW: Haven't spotted a solve for this one yet though...


It was solved in the third post of this thread



EDIT: Bollocks Trout me now too
_________________
"All fixed set patterns are incapable of adaptability or pliability. The truth is outside of all fixed patterns."

PostPosted: Thu Jul 05, 2007 5:46 pm
 View user's profile Yahoo Messenger
 Back to top 
ALISDAIRPARK
Unfictologist


Joined: 27 Nov 2005
Posts: 1646
Location: Everywhere else

Errrr yup, letter numbers match so I reckon that's it, didn't link the two together due to lack of explanation on it (like how solved etc.)

Worshippy your attention to the thread - you de man err people of any gender but who are better than wot I am! Wink
_________________
Absorb what is useful <> Reject what is not <> Add what is uniquely your own
Playing : http://cerebrumachine.com and http://www.westunfictionopia.info

My charity page: http://www.justgiving.com/alisdairpark3


PostPosted: Thu Jul 05, 2007 5:48 pm
 View user's profile
 Back to top 
James Stone
Decorated


Joined: 30 Sep 2006
Posts: 174
Location: England

ALISDAIRPARK wrote:
due to lack of explanation on it (like how solved etc.)


Yeah sorry about that. I used This DNA Decoder. Just throw the DNA code into the right side box and decrypt.

I don't quite understand the Doc's explanation. The text EMD0pncR1SZSYJs9 is repeated the specified 4 times, but in DNA format it is doesn't. I don't get it.
_________________
"All fixed set patterns are incapable of adaptability or pliability. The truth is outside of all fixed patterns."

PostPosted: Thu Jul 05, 2007 5:53 pm
 View user's profile Yahoo Messenger
 Back to top 
xHxBombxKatanax
Boot


Joined: 04 Jul 2007
Posts: 19
Location: California

New Website Feature!
Order

click on the pic next to the link for the rabbit hole and u go here

several wavs there and 3 messages in different languages.
Quote:
מאז נכנסתי לפוליטיקה, אני בעיקר היה בעל השקפות הגברים גילו אלי באופן פרטי. הם יודעים שיש כוח אישם כל כך אירגן, כל כך
דק, כל כך ערני, כל כך ינטארלוקאד, כל כך שלם, כל כך חודר, שלא היתה להם יותר טוב לא מדבר מעל הנשימה שלהם כאשר הם
מדברים בהרשעה של זאת.


إن شكوكنا خائنون و تجعلنا خسر جيد oft نحن ( تربح قوة عندما خاف بأن يحاول.


Характер человека его судьба.

Junk_DNA_audio1.wav
Description  wav file found on page
wav

 Download 
Filename  Junk_DNA_audio1.wav 
Filesize  485.51KB 
Downloaded  94 Time(s) 
Junk_DNA_audio2.wav
Description  another one
wav

 Download 
Filename  Junk_DNA_audio2.wav 
Filesize  177.54KB 
Downloaded  84 Time(s) 

PostPosted: Thu Jul 05, 2007 6:19 pm
Last edited by xHxBombxKatanax on Thu Jul 05, 2007 6:30 pm; edited 2 times in total
 View user's profile AIM Address
 Back to top 
Rogi Ocnorb
I Have 100 Cats and Smell of Wee


Joined: 01 Sep 2005
Posts: 4266
Location: Where the cheese is free.

Re: Kloos

James Stone wrote:
Umm the grid is also solved. I received an email from the Doc:

Quote:
It appears that you have found a shortcut to solving the junk DNA sequence by using a code generator. The repeating sequence that began my message embedded in the DNA sample repeated after a set number of junk DNA letters: 6, 8, 32 and 38 letters, respectively. The key to finding which junk sequences should be discarded was encoded in the first Magic Square by locating the substituted numbers from the original grid: 6, 8, 32, and 38. There is one other key encoded in the first Magic Square.

Sincerely,
JOSHUA AMBERGRIS

Specifically, those were:
Code:
ACTGTA
CGTAGCTA
ACTGTATAGCGATAGTGCTACATAGCTAGTCA
ACTATTGCGATAGCTTAAGACTAGATGTCTATATACAT


If someone could help me with "The key to finding which junk sequences should be discarded was encoded in the first Magic Square by locating the substituted numbers from the original grid: 6, 8, 32, and 38. There is one other key encoded in the first Magic Square.", I'd appreciate it.

The first six (eighteen), sure. But, after that Question
_________________
I'm telling you now, so you can't say, "Oh, I didn't know...Nobody told me!"


PostPosted: Thu Jul 05, 2007 6:24 pm
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 Back to top 
thedude07
Boot

Joined: 05 Jul 2007
Posts: 18

Re: New Website Feature!

xHxBombxPunkxKatanax wrote:
click on the pic next to the link for the rabbit hole and u go here[/code]


well i googled it and it is a diary of a person. heres the link

http://translate.google.com/
translate?hl=en&sl=ru
&u=http://www.liveinternet.ru/users/690930/&sa=X&oi=translate
&resnum=2&ct=result&prev=/search
%3Fq%3D%2522%25D0%25A5%25D0%25B0%25D1%2580%25D0
%25B0%25D0%25BA%25D1%2582%25D0%25B5%25D1%2580%2B
%25D1%2587%25D0%25B5%25D0%25BB%25D0%25BE%25D0%25B2
%25D0%25B5%25D0%25BA%25D0%25B0%2B%25D0%25B5%25D0
%25B3%25D0%25BE%2B%25D1%2581%25D1%2583%25D0%25B4
%25D1%258C%25D0%25B1%25D0%25B0%2522%26hl%3Den%26sa
%3DG

(moderator note: super-wide URLs -- such as the one above was all on one line -- make the forum a side-scrolling nuisance, and are usually unnecessary -- just give people a link to a translator and let them paste the foreign text in themselves, there is no need to have it be part of the URL, thank you -- catherwood)

PostPosted: Thu Jul 05, 2007 6:30 pm
 View user's profile
 Back to top 
thedude07
Boot

Joined: 05 Jul 2007
Posts: 18

Re: New Website Feature!

[quote="thedude07"]
xHxBombxPunkxKatanax wrote:
click on the pic next to the link for the rabbit hole and u go here[/code]



here's another link:
http://translate.google.com/
translate?hl=en&sl=ru
&u=http://www.li.ru/interface/pda/%3Fjid%3D690930&sa=X
&oi=translate&resnum=3&ct=result
&prev=/search
%3Fq%3D%2522%25D0%25A5%25D0%25B0%25D1%2580
%25D0%25B0%25D0%25BA%25D1%2582%25D0%25B5%25D1
%2580%2B%25D1%2587%25D0%25B5%25D0%25BB%25D0%25BE
%25D0%25B2%25D0%25B5%25D0%25BA%25D0%25B0%2B%25D0
%25B5%25D0%25B3%25D0%25BE%2B%25D1%2581%25D1%2583
%25D0%25B4%25D1%258C%25D0%25B1%25D0%25B0%2522%26hl
%3Den%26sa%3DG

(moderator note: super-wide URLs -- such as the one above was all on one line -- make the forum a side-scrolling nuisance, and are usually unnecessary -- just give people a link to a translator and let them paste the foreign text in themselves, there is no need to have it be part of the URL, thank you -- catherwood)

PostPosted: Thu Jul 05, 2007 6:35 pm
 View user's profile
 Back to top 
xHxBombxKatanax
Boot


Joined: 04 Jul 2007
Posts: 19
Location: California

why would it be a diary of some russian lady? i cant get in to read the translated diary, so i tried signing up but i cant read a thing on the site, let alone navigate to the page! lol
_________________
Common sense is not so common Wink

PostPosted: Thu Jul 05, 2007 6:41 pm
 View user's profile AIM Address
 Back to top 
thedude07
Boot

Joined: 05 Jul 2007
Posts: 18

does anyone know the dude's e-mail address or phone number

PostPosted: Thu Jul 05, 2007 6:52 pm
 View user's profile
 Back to top 
xHxBombxKatanax
Boot


Joined: 04 Jul 2007
Posts: 19
Location: California

Contacts

e-mail = no
phone= yes
877.234.3830
on his myspace
the company's phone is 888.201.5221
their e-mail is on the website
_________________
Common sense is not so common Wink

PostPosted: Thu Jul 05, 2007 6:58 pm
 View user's profile AIM Address
 Back to top 
thedude07
Boot

Joined: 05 Jul 2007
Posts: 18

so......

so...anyone find anything?

PostPosted: Thu Jul 05, 2007 7:13 pm
 View user's profile
 Back to top 
thedude07
Boot

Joined: 05 Jul 2007
Posts: 18

got something

i don't think this is important, but i found it on the site. may have something to do with that werid message about heaven
heaven_above[1].wav
Description 
wav

 Download 
Filename  heaven_above[1].wav 
Filesize  314.74KB 
Downloaded  85 Time(s) 
something.wav
Description 
wav

 Download 
Filename  something.wav 
Filesize  246.3KB 
Downloaded  84 Time(s) 

PostPosted: Thu Jul 05, 2007 7:16 pm
 View user's profile
 Back to top 
Display posts from previous:   Sort by:   
Page 13 of 37 [546 Posts]   Goto page: Previous 1, 2, 3, ..., 11, 12, 13, 14, 15, ..., 35, 36, 37  Next
View previous topicView next topic
 Forum index » Archive » Archive: General » Low-Volume Games
Jump to:  

You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group