Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
 
The time now is Fri Nov 22, 2024 12:56 am
All times are UTC - 4 (DST in action)
View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: General » Low-Volume Games
[GC] The Genesis Code Trailhead: Triad Genomics
View previous topicView next topic
Page 15 of 37 [546 Posts]   Goto page: Previous 1, 2, 3, ..., 13, 14, 15, 16, 17, ..., 35, 36, 37  Next
Author Message
ghelman
Boot

Joined: 05 Jul 2007
Posts: 10

there is something i can say though, the language is written from right to left, but the actual sentence is aligned left. this means that the statement actually begins with this word מאז. keep that in mind while translating or it will be bugged out

PostPosted: Thu Jul 05, 2007 8:53 pm
 View user's profile
 Back to top 
xHxBombxKatanax
Boot


Joined: 04 Jul 2007
Posts: 19
Location: California

Translations
Updating this post constantly ;)

Hebrew
Quote:
Since I entered politics, I have chiefly had men's views confided to me
privately. Some of the biggest men in the United States, in the field of
commerce and manufacture, are afraid of somebody, are afraid of something.
They know that there is a power somewhere so organized, so subtle, so
watchful, so interlocked, so complete, so pervasive, that they had better
not speak above their breath when they speak in condemnation of it.

-Woodrow Wilson

Arabic
Quote:
Our doubts are traitors and make us lose the good we oft might win, by fearing to attempt.

-Shakespeare

Russian
Quote:
The disposition of person it fate.


Ok, everything's clarified except the Russian text. When we find that, I will add it in.

PostPosted: Thu Jul 05, 2007 9:12 pm
Last edited by xHxBombxKatanax on Fri Jul 06, 2007 9:20 pm; edited 7 times in total
 View user's profile AIM Address
 Back to top 
dadirtyhippo
Greenhorn

Joined: 28 Jun 2007
Posts: 5

I'm in. My first ARG. I have been following the threads and hopefully I can contribute.

PostPosted: Thu Jul 05, 2007 9:16 pm
 View user's profile AIM Address MSN Messenger
 Back to top 
James Stone
Decorated


Joined: 30 Sep 2006
Posts: 174
Location: England

There is an IRC chat room #genesiscode for this ARG set up so we can discuss theories etc.

If you don't have your own IRC then click here. Enter a nickname, and the channel #genesiscode

If you have your own IRC then:

Server Name: irc.chat-solutions.org
Server Port: 6667

Enjoy
_________________
"All fixed set patterns are incapable of adaptability or pliability. The truth is outside of all fixed patterns."

PostPosted: Thu Jul 05, 2007 9:21 pm
 View user's profile Yahoo Messenger
 Back to top 
dadirtyhippo
Greenhorn

Joined: 28 Jun 2007
Posts: 5

Transcript and source of junk_DNA_audio1.wav

The oldest Egyptian or Hindoo philosopher raised a corner of the veil from the statue of the divinity; and still the trembling robe remains raised, and I gaze upon as fresh a glory as he did, since it was I in him that was then so bold, and it is he in me that now reviews the vision.

From Henry David Thoreau's Walden
Essay titled Reading

PostPosted: Thu Jul 05, 2007 9:37 pm
 View user's profile AIM Address MSN Messenger
 Back to top 
thedude07
Boot

Joined: 05 Jul 2007
Posts: 18

Re: Transcript and source of junk_DNA_audio1.wav

dadirtyhippo wrote:
The oldest Egyptian or Hindoo philosopher raised a corner of the veil from the statue of the divinity; and still the trembling robe remains raised, and I gaze upon as fresh a glory as he did, since it was I in him that was then so bold, and it is he in me that now reviews the vision.

From Henry David Thoreau's Walden
Essay titled Reading


incase you just joined, we already got that

PostPosted: Thu Jul 05, 2007 11:02 pm
 View user's profile
 Back to top 
tipsila
Unfettered


Joined: 10 Apr 2006
Posts: 545
Location: In the back of your mind

Yes, but dadirtyhippo gave us a transcription (some people can't listen to them), and also the source of the quote.

Cowabella transcribed some of the earlier ones, here. We still need Junk_DNA_audio2.wav and Journal_1_Heading.wav transcribed. Feel free to do so. Smile

PostPosted: Thu Jul 05, 2007 11:29 pm
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 Back to top 
agentgr33n
Unfettered


Joined: 25 Jun 2007
Posts: 574

the arabic quote is shakespeare....
http://thinkexist.com/quotation/our_doubts_are_traitors_and_make_us_lose_the_good/15145.html


the other 2 not so much....whats Yntarlokad?

PostPosted: Thu Jul 05, 2007 11:38 pm
 View user's profile AIM Address Yahoo Messenger
 Back to top 
RAF92_Moser
Boot

Joined: 03 Jul 2007
Posts: 11

Transcript of Journal_1_Heading

Quote:
From the Journal of Dr. Joshua Ambergris, March 8th entry.


PostPosted: Fri Jul 06, 2007 12:00 am
 View user's profile
 Back to top 
thedude07
Boot

Joined: 05 Jul 2007
Posts: 18

tipsila wrote:
Yes, but dadirtyhippo gave us a transcription (some people can't listen to them), and also the source of the quote.

Cowabella transcribed some of the earlier ones, here. We still need Junk_DNA_audio2.wav and Journal_1_Heading.wav transcribed. Feel free to do so. Smile


can you gimme the link to those? i can transcript them

PostPosted: Fri Jul 06, 2007 12:15 am
 View user's profile
 Back to top 
xHxBombxKatanax
Boot


Joined: 04 Jul 2007
Posts: 19
Location: California

Mcgritts wrote:
the arabic quote is shakespeare....
http://thinkexist.com/quotation/our_doubts_are_traitors_and_make_us_lose_the_good/15145.html


the other 2 not so much....whats Yntarlokad?


I have no idea, it translates that way every time.
_________________
Common sense is not so common Wink

PostPosted: Fri Jul 06, 2007 12:40 am
 View user's profile AIM Address
 Back to top 
RAF92_Moser
Boot

Joined: 03 Jul 2007
Posts: 11

Re: Kloos

Quote:
It appears that you have found a shortcut to solving the junk DNA sequence by using a code generator. The repeating sequence that began my message embedded in the DNA sample repeated after a set number of junk DNA letters: 6, 8, 32 and 38 letters, respectively. The key to finding which junk sequences should be discarded was encoded in the first Magic Square by locating the substituted numbers from the original grid: 6, 8, 32, and 38. There is one other key encoded in the first Magic Square.

Sincerely,
JOSHUA AMBERGRIS



Quote:
If someone could help me with "The key to finding which junk sequences should be discarded was encoded in the first Magic Square by locating the substituted numbers from the original grid: 6, 8, 32, and 38. There is one other key encoded in the first Magic Square.", I'd appreciate it.


Dr. Ambergris meant that if you count six junk DNA letters from the beginning, the message will begin. After the message is over, you count eight junk DNA letters before it begins again. Then you count thirty-two, message is repeated, then you count 38, then it begins again.

The entire message lies in this code:

Code:
AGGTCTTTGTCTGGTGTATCGTTGTTAGGAGCATCCTCGTTGCAGTACTCTGGATCCTACGCAT
CTGTATAGTACGCAGTTTTGAGTGTATAGGGGGGATACGGATCTGTAGCGTCGTTGATATAGTACGGCGG
ATCCGGATACGCGGGATTGCAGTTGTGGGTAGTTGTTTTGTGATACTGCGGAGTAGTTTTGTCTGGTGGA
TTGTCGGGAGCGTCCGGATCTTTGTAGGGCTTGTCTGGTGGATTGGGGGGATACGGATCGGTATCGTTG
GCGTAGGCTGGATTGGCATACTTGGCATACGCGGTAGGATACTCTTTGTCGGGAGCGTCCGGATCTTTG
GGCTCCTAGTAATTGGGAGCATCCTCTGGTTCGTTGTAGGTTGCTGGATCGTCTTTGGCGGTATGCGTAG
TTGTATTCGCATCTGTATAGTACTCGTTGGCATACGCTTTGGCATTGGGGGTTTAGGCCGCAGTTTTGGC
GTAGTACTCGTATGTATCCGCAGCGTTATTGTCTGGTGCATCTTTGTCGTATGCATACTCGTTGTCTGGTG
GATTGGCCTCCGGAGCAGCTTCTGGTTTGTAGGGCTTGGGTTGATAAGCATACTTGGGTGTATCGTCTTA
GTCCTTA


If you search for it on the junk DNA matrix, you will find it appear four times.

PostPosted: Fri Jul 06, 2007 12:53 am
 View user's profile
 Back to top 
Solar Wind Tripper
Boot


Joined: 15 Jan 2007
Posts: 14
Location: Twin Cities

Just an idea but...

Quote:
....whats Yntarlokad?


This got me thinking...what if someone wrote an english word phonetically in Hebrew? I've seen that done as a gag before. In that case, Yntarlokad = interlocked.

Edit: I went back and looked through the Hebrew. I never learned to translate more than a couple words, but I can sound out the letters alright. ינטארלוקאד = Yntarlokad, phonetically. The translator just sounded it out. If not "interlocked", maybe it's a name?

PostPosted: Fri Jul 06, 2007 1:02 am
Last edited by Solar Wind Tripper on Fri Jul 06, 2007 1:08 am; edited 1 time in total
 View user's profile
 Back to top 
xHxBombxKatanax
Boot


Joined: 04 Jul 2007
Posts: 19
Location: California

Confusion

Quote:
Dr. Ambergris meant that if you count six junk DNA letters from the beginning, the message will begin. After the message is over, you count eight junk DNA letters before it begins again. Then you count thirty-two, message is repeated, then you count 38, then it begins again


so... count six over and the message starts. but where does it end? how long is the message?

EDIT: ok then ill change yntarlokad to interlocked.
_________________
Common sense is not so common Wink

PostPosted: Fri Jul 06, 2007 1:04 am
 View user's profile AIM Address
 Back to top 
Solar Wind Tripper
Boot


Joined: 15 Jan 2007
Posts: 14
Location: Twin Cities

Re: Confusion

xHxBombxPunkxKatanax wrote:

EDIT: ok then ill change yntarlokad to interlocked.


It's just a guess, but if you like it, please do.

PostPosted: Fri Jul 06, 2007 1:10 am
 View user's profile
 Back to top 
Display posts from previous:   Sort by:   
Page 15 of 37 [546 Posts]   Goto page: Previous 1, 2, 3, ..., 13, 14, 15, 16, 17, ..., 35, 36, 37  Next
View previous topicView next topic
 Forum index » Archive » Archive: General » Low-Volume Games
Jump to:  

You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group