Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
  

The time now is Fri Nov 15, 2024 11:30 pm
All times are UTC - 4 (DST in action)		 View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: General » Low-Volume Games
[GC] [New Site] TheGenesisConspiracy.com
View previous topicView next topic
Page 5 of 7 [104 Posts]   Goto page: Previous 1, 2, 3, 4, 5, 6, 7 Next
Author Message
gambler
Boot

Joined: 07 Aug 2007
Posts: 43

 		DNA code
Rogi Ocnorb wrote:
Thought I'd try to reverse engineer some text and see if there was a way to figure out which type of Base64 binary encoding was applied to the text in our Junk_DNA.


Not sure I understand all of what you did Rogi, but I can tell you how to decipher messages without using the online tool. Sorry if this was posted elsewhere, I've been following quite closely but I could have missed something!

1. The bases A, C, G and T are the numbers 0, 1, 2 and 3 respectively in base 4 triplets.
2. The numbers 0-9 are represented by their numbers in quaternary triplets using the numbers above. Thus 0=AAA and 9=AGC.
3. The capital letters and then the lower case letters then follow in sequence so that A=10=AGG, B=11=AGT, etc. and a=36=GCA, b=37=GCC, etc.
4. Space=62=TTG, %=63=TTT. The % character can be used to escape characters which do not fit in the normal code (eg. punctuation), using the hexadecimal representation of the ASCII code (as you would in a URL).
5. The incorrect entries in the magic square on the myspace blog we found way back at the start of the game give offsets into the code after which the message repeats.

Is that what you meant or have I missed the point?

PostPosted: Tue Sep 11, 2007 5:30 pm
 View user's profile
 Back to top 
emato
Unfettered


Joined: 06 Aug 2007
Posts: 333
Location: Florida

 		I've been playing around with graphic files to see if any were stegged. Of course using stegdetect creates a bunch of false positives. [sigh] At least when I checked with jpseek it was bogus OR (big possibility) I didn't have the password (pass phrase - etc).

So didn't get anywhere there.

Also revisited all the threads --- Shocked

Just started playing around with the .wav files and found some interesting things -- having a hard time isolating them though. Just started using Audacity so have been playing mostly.

Have noticed 4320 Everywhere on the sites. They have been gradually changing -- even the number of players on the CF site has the number.

Must be something we need to do with it no?

Anyway ...

Waiting for my book to come from Amazon. This weekend I went to the next town (hour away) into a Books-a-Million (sold out!) and a Barnes and Nobel. My local Walmart won't get it until the end of the month! Good ole Amazon!

PostPosted: Tue Sep 11, 2007 7:40 pm
 View user's profile Visit poster's website
 Back to top 
Rogi Ocnorb
I Have 100 Cats and Smell of Wee


Joined: 01 Sep 2005
Posts: 4266
Location: Where the cheese is free.

 		Re: DNA code
gambler wrote:
Is that what you meant or have I missed the point?


No. You've got it right.
I was doing a knee-jerk reply to another post and had forgotten about the original surprised reply telling us about the offsets for the 4 copies of the Junk DNA message. I was just spinning my wheels looking for something that wasn't there. Trout
_________________
I'm telling you now, so you can't say, "Oh, I didn't know...Nobody told me!"


PostPosted: Wed Sep 12, 2007 2:10 am
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 Back to top 
lestat5891work
Veteran

Joined: 05 Sep 2007
Posts: 143
Location: Wilmington, North Carolina

 		Is going back to a previous puzzle still the current plan?

PostPosted: Wed Sep 12, 2007 3:08 pm
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 Back to top 
eegleburger
Decorated

Joined: 30 Aug 2007
Posts: 184
Location: Dallas, Texas
lestat5891work wrote:
Is going back to a previous puzzle still the current plan?


yeah, we probably missed something.

PostPosted: Wed Sep 12, 2007 3:26 pm
 View user's profile Visit poster's website AIM Address
 Back to top 
emato
Unfettered


Joined: 06 Aug 2007
Posts: 333
Location: Florida

 		JunkDNA revisited - again
and the 'broken' magic square
Edited to clarify -

Ok - so the JunkDNA page at TG gave us the key : The broken magic square gave us: 6,8,32,38 from the numbers that repeated and needed to be replaced. That gave us 4 strings of junk dna that separated out the message 4 times from the JunkDNA page.

Strings:
6 = ACTGTA
8 = CGTAGCTA
32= ACTGTATAGCGATAGTGCTACATAGCTAGTCA
38= ACTATTGCGATAGCTTAAGACTAGATGTCTATATACAT

Which led to the following message being repeated 4x:

Quote:
At this years International Biogenetics Conference I will unveil the secret of the genesis code an ancient secret from earths oldest civilizations and a global conspiracy that spans the breadth of human history


When I did the whole JunkDNA block in the decoder - I only got 2 of the messages and 'junk' in between. So I did it manual and found the error of my way!

Now - the letter from the doc way back in the first thread says:

Quote:
It appears that you have found a shortcut to solving the junk DNA sequence by using a code generator. The repeating sequence that began my message embedded in the DNA sample repeated after a set number of junk DNA letters: 6, 8, 32 and 38 letters, respectively. The key to finding which junk sequences should be discarded was encoded in the first Magic Square by locating the substituted numbers from the original grid: 6, 8, 32, and 38. There is one other key encoded in the first Magic Square.

Sincerely,
JOSHUA AMBERGRIS


So maybe we need to revisit the JunkDNA and the 'broken' magic square?
The numbers that were missing and needed to be substituted were:

33,39,57,64 I have been trying to find a way to use these words/letters/dna codes etc and haven't been successful yet.

I've tried the 33rd, 39th etc... letter of the decoded message and don't really get anything. Tried whole words but the longest word is 39 - International then - Nada.

Anyway - what do you all think about "There is one other key encoded in the first Magic Square. "

And I don't think we've found it yet ... or have we? Screwy

PostPosted: Wed Sep 12, 2007 8:07 pm
Last edited by emato on Wed Sep 12, 2007 9:41 pm; edited 1 time in total
 View user's profile Visit poster's website
 Back to top 
eegleburger
Decorated

Joined: 30 Aug 2007
Posts: 184
Location: Dallas, Texas

 		Re: JunkDNA revisited - again
and the 'broken' magic square
emato wrote:


So maybe we need to revisit the JunkDNA and the 'broken' magic square?
The numbers that were missing and needed to be substituted were:

33,39,57,64 I have been trying to find a way to use these words/letters/dna codes etc and haven't been successful yet.

I've tried the 33rd, 39th etc... letter of the decoded message and don't really get anything. Tried whole words but the longest word is 39 - International then - Nada.

Anyway - what do you all think about "There is one other key encoded in the first Magic Square. "



please tell me what to do and I'll gladly do it, if only to understand Crying or Very sad

PostPosted: Wed Sep 12, 2007 9:00 pm
Last edited by eegleburger on Thu Sep 13, 2007 12:16 pm; edited 1 time in total
 View user's profile Visit poster's website AIM Address
 Back to top 
GlitteringGold
Veteran


Joined: 31 Jul 2007
Posts: 70

 		Expanded Books
New link posted to the top of http://www.thegenesisconspiracy.com for Expanded Books. The direct link for the video for The Genesis Code is here: http://tinyurl.com/22vojg

Is it PR? Or does it contain clues? I'm watching it now....

Edit: I didn't see any *obvious* clues.

PostPosted: Thu Sep 13, 2007 11:40 am
 View user's profile
 Back to top 
eegleburger
Decorated

Joined: 30 Aug 2007
Posts: 184
Location: Dallas, Texas

 		looks like PR to me, but then again, I didn't really pay attention (yay for writing essays for class). maybe we need to look over some parts of the video again when numbers and stuff pop up.

wow, I'm pretty miffed that those two couldn't produce Nguyen correctly. Confused

PostPosted: Thu Sep 13, 2007 12:27 pm
 View user's profile Visit poster's website AIM Address
 Back to top 
pretense
Boot

Joined: 09 Sep 2007
Posts: 16

 		If anyone wants to get crazy and go frame by frame I've got an mpg version of it up here:

http://comebackwithawarrant.com/genesispr.mpg

Honestly, though, it's fairly clear that this was developed/edited and produced by the folks at expanded books + maybe his publicist. I would be surprised to find elements of the ARG (though it is cool how many photos have been used in it) in the video.

PostPosted: Thu Sep 13, 2007 3:27 pm
 View user's profile
 Back to top 
emato
Unfettered


Joined: 06 Aug 2007
Posts: 333
Location: Florida

 		Re: Expanded Books
GlitteringGold wrote:
New link posted to the top of http://www.thegenesisconspiracy.com for Expanded Books. The direct link for the video for The Genesis Code is here: http://tinyurl.com/22vojg

Is it PR? Or does it contain clues? I'm watching it now....

Edit: I didn't see any *obvious* clues.


I did a couple frame captures - I'm not sure how to post them yet but mostly the numbers that scrolled up were (from bottom to top) 22,27,38,12,5,60. (maybe from the Magic Squares)

Arabic or Hebrew characters?

The names of books flashed:
The Book of Enoch ( http://en.wikipedia.org/wiki/Book_of_Enoch )
Yih-King (I-Ching) Book of Changes

Edited for spelling

PostPosted: Thu Sep 13, 2007 3:31 pm
 View user's profile Visit poster's website
 Back to top 
pretense
Boot

Joined: 09 Sep 2007
Posts: 16

 		There was also the [google]Sefer Yetzirah[/google] and [google]Tabula Smaragdina[/google]

PostPosted: Thu Sep 13, 2007 3:51 pm
 View user's profile
 Back to top 
eegleburger
Decorated

Joined: 30 Aug 2007
Posts: 184
Location: Dallas, Texas

 		Has anyone actually read the book? Maybe they could shed some insight so we have some kind of direction to look to.

PostPosted: Thu Sep 13, 2007 9:54 pm
 View user's profile Visit poster's website AIM Address
 Back to top 
emato
Unfettered


Joined: 06 Aug 2007
Posts: 333
Location: Florida

 		Close encounter
eegleburger wrote:
Has anyone actually read the book? Maybe they could shed some insight so we have some kind of direction to look to.


I am waiting for Amazon to deliver mine. Used to be from Miami with bookstores at every corner -- now in the boon-docks but at least I have Internet! Laughing

Today someone was creeping around my window and freaked me out! Not exactly MIB (he was wearing shorts and sandles), but someone from Sarasota, FL who I saw out of my window while reading the UF board!!!! See, I live on 5 wooded acres so it was a bit of a shock! Shocked Silly

First thing in my mind was about the game/book/ARG !!!!! Laughing

PostPosted: Fri Sep 14, 2007 7:51 pm
 View user's profile Visit poster's website
 Back to top 
eegleburger
Decorated

Joined: 30 Aug 2007
Posts: 184
Location: Dallas, Texas

 		Re: Close encounter
emato wrote:

Today someone was creeping around my window and freaked me out! Not exactly MIB (he was wearing shorts and sandles), but someone from Sarasota, FL who I saw out of my window while reading the UF board!!!! See, I live on 5 wooded acres so it was a bit of a shock!


haha, that's crazy! I would have started screaming then broken down into tears. Shocked

The PR video kind of told everyone the summary of the story. Has anyone contacted the two geneticists?

PostPosted: Sat Sep 15, 2007 11:29 pm
 View user's profile Visit poster's website AIM Address
 Back to top 
Display posts from previous:   Sort by:   
Page 5 of 7 [104 Posts]   Goto page: Previous 1, 2, 3, 4, 5, 6, 7 Next
View previous topicView next topic
 Forum index » Archive » Archive: General » Low-Volume Games
Jump to:  


You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group