Return to Unfiction unforum
 a.r.g.b.b 
FAQ FAQ   Search Search 
 
Welcome!
New users, PLEASE read these forum guidelines. New posters, SEARCH before posting and read these rules before posting your killer new campaign. New players may also wish to peruse the ARG Player Tutorial.

All users must abide by the Terms of Service.
Website Restoration Project
This archiving project is a collaboration between Unfiction and Sean Stacey (SpaceBass), Brian Enigma (BrianEnigma), and Laura E. Hall (lehall) with
the Center for Immersive Arts.
Announcements
This is a static snapshot of the
Unfiction forums, as of
July 23, 2017.
This site is intended as an archive to chronicle the history of Alternate Reality Games.
 
The time now is Sun Nov 17, 2024 2:55 pm
All times are UTC - 4 (DST in action)
View posts in this forum since last visit
View unanswered posts in this forum
Calendar
 Forum index » Archive » Archive: General » Old News & Rumors
Ice Shock - The Descendant - book promotion ARG
View previous topicView next topic
Page 2 of 2 [29 Posts]   Goto page: Previous 1, 2
Author Message
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Another Habbo meeting with Josh & Gabi tomorrow (11-Mar-09)

JOSH'S BLOG updated with new "Jackson's blog..." thread. He basically tells Gabi to be careful when documenting their search. Based on Habbo room notes, he realizes visibility is elevated and technically they don't know what our (the collective detectives) motives are.
Josh's blog wrote:
Can we meet again to chat?

Tomorrow in Habbo, my MariposaJosh room, 11:30 your time 17:30 mine, okay?


-Same thing applies as the other meeting:
Location: HABBO
Room: MariposaJosh
PW: Orizaba
Time: 11:30 AM CST
9:30 AM PST ETA: My bad, its 10:30 AM PST / 1730 Wink

Meta-ish side note: MG Harris peeked from behind the curtain and sent me an OOG email this morning. I am stoked to say that she is going to send me a signed copy of Ice Shock Very Happy -Man that is awesome!!! Looks like I'm not waiting til the end of this month to be able to read it!!!

ETA:
Ok GABI'S BLOG has a new vid "Aunty is involved". She basically states that Maria Carmen Valencia or "MCV" from JB's SITE is her Aunt (her Father / PJ's favorite cousin). And it was MCV's phone # that was on the Vial of bio-material that PJ passed to JB before he got shot (primarily the reason JB started his blog & correspondance with MCV). Note: At the end of the vid, Gabi states:
Gabi from Aunty is involved wrote:
...it was a message from my father, a secret message, with the phone number of the only person who could be trusted to help him. My aunt Maria carmen, of coarse I called her right away...

ETA2:
The DROP.IO location now has a chat channel enabled

Also: Gabi dropped another vid "Men in Grey". Looks like the suits in the black Explorer might have MCV's appt under surveillance. Hope they didn't catch a glimpse of the lisc plate on the Vespa Shocked because if they did, her friend Jessica & her brother Felix might be getting an unexpected visit from the men in grey...
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Tue Mar 10, 2009 4:30 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Second Habbo chat and new wesite documented...

OK so the chat went down again and I attached the transcript below. Also: major clue to find this website hehehe I tried already based on the promo vid though Wink -Its very obvious from the transcript so no spoiler here:
http://poborsky.com/poborsky-guide.swf

Note: That link is to the lab that "Magda Poborska" works at (see JB's blog starting at post #23 I believe).

ETA:
Ok when you look at the lab site (above) and you watch the new video on Gabi's blog titled "Waiting", you can identify the Beltran Vial as being the one from the pic I attached below. - The number sequence on the vial is: 55.8G.21.43.99
This is what you get:
Spoiler (Rollover to View):
Substitute the "G" for numeric "4" and the number is: 55.84.21.43.99
IE: Mexico City area code 55 + 8 digit phone number
From my area I dial: 011 52 55 84214399
Ref on dialing: THIS URL

-Its MCV's phone number and she leaves the following message (I'm going to leave my number tomorrow heheheeh):
"Hi you've reached Maria Carmen Valencia, I guess I'm out or we'd already be talking. If you know my cell number, you should try that, if not then I guess I'll call you later. Hasta la huego!"

Also: I was going to run a lab analysis on the Beltran sequence, but the site currently states:
Poborsky Labs page wrote:
*** All Services ***
* currenlty Unavailable due to system upgrades *
*** Check back soon for updates ***

ETA2:
Vid "Saying Goodbye" posted to Gabi's with comments from Josh.
HabboChat2Mar_11th.txt
Description 
txt

 Download 
Filename  HabboChat2Mar_11th.txt 
Filesize  3.62KB 
Downloaded  407 Time(s) 
PJB_Vial_PoborskyLab.jpg
 Description   
 Filesize   15.45KB
 Viewed   1168 Time(s)

PJB_Vial_PoborskyLab.jpg

_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Wed Mar 11, 2009 3:48 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Poborsky Lab DNA results now active...

The Poborsky lab site tests are partially functional now (allows you to pick a vial and run some tests). I submitted a test (for the vial in the pic on the previous thread) a couple days ago and this morning I got the results. The results are exactly what I thought they would be because as I mentioned about a week ago, I read JB's thread #'s 54,55,56 and did these tests myself on Expasy & Blast. But for the record, heres the email I got back from the lab:
DNA Sequencing - Magda Poborsky's Online Lab wrote:
Dear Sean Psysop,

As requested, here is the sequence data from the DNA analyzer:

GCAGGUUACCUAAUCCAUCGUCCCCCGCGUGAGAUUAAGGGUCGG

Protein translation: 1 continuous open reading frame

5'3' Frame 1

A G Y L I H R P P R E I K G R

ExPASY: http://www.expasy.ch/tools/dna.html

Blast: http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=BlastHome

Thanks for using Magda Poborsky's Online Lab.

Also: The results basically rehash the fact that the sequence is the url for the chatbot/Runig's page. For those that don't get wth I'm saying, for the sake of clarity heres how you get these results:
JB's thread # 55 gives you the Beltran Sequence: GGUUACCUAAUCCAU.
You take that & go to THIS ExPASy page & paste the sequence in the field, click "Translate Sequence". The result is the letters from Runig's URL and by clicking the "A" link you can verify the sequence is 15 amino acids etc etc...
Gabi's blog has a couple more vids with commentary going back & forth from her and Josh as well. I'm going to start digging based on TheOldMan49's latest tweet.

ETA: OK TheOldMan49 is just referencing what we know already (the sequence is Runig's url). Looks like I'm going to have another talk with Runig to see if I can learn anything else...

ETA2:
JOSH'S BLOG updated with entry "Mysterious incidents...my turn to tell you..." where he states this character (from Ice Shock):
Josh's Mysterious incidents... Blog entry wrote:
Rodrigo remembered doing a lunchtime concert that day. He'd bumped into my dad in the morning, before the concert.
My point: I knew that MG used a family friend to base this character on Rodrigo Del Pozo because I read HER BLOG HERE.
Based on that, I started looking for Blogs and found this: http://delpozo.blogspot.com/
[Pure Spec] The only reason I think this is strange is because I looked up that blog weeks ago & there weren't any entries. I just looked again now and see this:
Bienvenidos al Primer Posting de Nuestro Blog wrote:
Sean ustedes bienvenidos al primer posting de nuestro blog.
Sean Psysop is my alias... But the name on the profile is "Ricardo", not Rodrigo heheeh I have no kl00 if this has anything to do with this though... This is bizarre Confused hehe I am probably just tripping digging around for a double meaning because Sean in this form can mean like "you are all" heheheh its very strange usage of spanish. Sorry if I threw anyone off hehehe this probably has nothing to do with the ARG, I just found it strange...

Finally: Josh mentions Saffron Walden as a location. Heres a ref for that (note: the maze/labyrinth):
http://en.wikipedia.org/wiki/Saffron_Walden

ETA3:
I think I should get my copy of Ice Shock by or before this Friday. If that happens, I will spoil post the code as it is now known that the code directly relates to the ARG and will be the pw for an in game site appearing sometime in the near future. -Btw, Gabi has posted a new vid titled "Found in Translation" and it looks like her and Josh will be setting up another Habbo meeting soon as well.
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Tue Mar 17, 2009 3:49 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Gabi and Hans Runig

Gabi posted a new vid titled "Close Call" with a rather large comment to Josh explaining how the DNA sequence is the URL for Runig's page etc. The comment also has the following chat that she had with Runig:
Gabi to Runig wrote:
>>> How can you kill people? How can you take life?
Aha! I wonder – are you perhaps the girl on the vespa – who was visiting Dr. Valencia? La vida es la barata, pequeña, pero el mundo no lo es.
The Spanish translates to: "Life is cheap little one, but the world isn't". So based on that I went to Runigs page and figured out where the Ice Shock code is Probably supposed to be used. Heres what I got:
Spoiler (Rollover to View):
Right when Runigs page loaded I input the following text as a pw based on the IP kick stating that page does have a password:
ninhursag

-after inputting that pw, you are brought to a sub-page that states (click on the Sumerian button):
Trace: -COMPLETE
Password Validation: -PASS
User: -AUTHORIZED
System: -ACTIVATED
Login: -ENABLED

After clicking the button, the next sub-page prompts you to:
"Please enter password to access this page" with a submit form... Ugh I need the pw from the book and I dont have the book yet Evil or Very Mad

-If anyone has the Ice Shock pw (fansite forum anyone? please hit me up)

ETA:
What great timing, I got home and my signed copy was delivered! Thank you MG!!! OK bb in a bit, gonna lift the code Very Happy
Spoiler (Rollover to View):
The Ice Shock code is (I added the spaces):

HELP MY FRIEND GABI BELTRAN DISCOVER THE
IDENTITY OF HER DADS MURDERER THE SECT OF
HURACAN HAS A PASSWORD IT IS NINHURSAG

The pw is the same for both sub-pages: ninhursag
Side Note: & yes I feel like a jackass for the following reasons. A: I actually attempted to guess the pw when I thought the book wasn't coming for a few more days (disclaimer: I used that password weeks ago and it wasn't active). B: I'm lame because it did not occur to me to input the same pw for both pages until I came home and saw I had the book Rolling Eyes
Btw, I tried Sectofhuracan last night based on this quote at this link: "Except that we're aware of the interest of shadowy groups like the Sect of Huracan in the 2012 mystery." -Ill keep my eye out for mention of that sect now Wink, as I have a feeling that this sect could be the anti-heros

OK so the pw's are listed above and that final destination page is very interesting with dosiers & audio! Im going to scour that thing later tonight. And of coarse read the book Cool

ETA2:
Note: I transliterated the Sumerian from the "Erinsi Tech" link (from the page spoiled above). Ill post the pic/key later when it makes more sense...Now I'm really going to read the book.
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Wed Mar 18, 2009 7:46 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Destination / Huracan Files page
at this point Im blocking info daily as separate threads for context...

Note: If I reference the "Huracan page" Im talking about the spoiled destination page above (based on the title of the .swf).

I was looking at the "Targets" & "Surveillance" links and wanted to note there are 2 characters w/last name "Bennett". IE: Dr. Jackson & Col. Connor Bennett. - They are twin brothers according to the "Revival Chamber 2" doc from Erinsi Tech. That explains why thier bios state they were born on the same day etc.

Of note: Col. Connor Bennett works for the Airforce & may/probably be associated to the NRO (joint USAF/NAVY/CIA task force)- He is apparently the Security specialist in charge of entry to Revival Chamber 2 located in Abu Shahrain, Iraq (both Runig & Chaldexx want access to that chamber to obtain the artefact). So far, I think neither group has been granted access with this caveat:
Erinsi Tech > Revival Chamber 2 link wrote:
Unfortunately, our approach of Col. Connor Bennett proved fruitless and has prevented our entry to the site. His awareness of our need has only made our access all the more difficult to achieve. However, we are now pursuing another approach utilising Bennett's twin brother, whith whom force will not be necessary.

I think the "Classification" and "Threat Levels" under "Targets" & "Surveillance" are as follows:
BLUE [zero - low surveillance priority / Eliminated-Deceased]
AMBER [medium priority / contact required-active surveillance]
RED [Elusive / Target (for elimination)]
GREEN [Engaged / Direct contact acquired]

With the levels stated:
Col. Bennett = Classification: Amber- Approach Refusal, Threat: Amber
Dr. Bennett (JB)= Classification: Green- Engaged, Threat: Amber (previously set at RED)

Notes on Marius Martineau & Simon Madison/Martineau From Ice Shock:
Spoiler (Rollover to View):
Supposedly Marius is Simon's dad. Again, Marius is the "Non-Executive Director" at Chaldexx...

ETA from 20-Mar:
Gabi posted vid "Countdown" last night. Looks like she thinks Runig killed her dad. She has also talked to Runig on the "Portal" (chat page), but her IP has not been traced yet (Runig has norrowed the trace down to Mexico City though). Its funny though, because surveillance on the Huracan page states that the sect knows her home address and they know about the vespa.
Corny note: XD her classification is: "RED: Elusive" though she doesnt seem that elusive to me. I would just send a van over to her neighbors to capture all in/out net traffic. Then recompile the data as output files.

Another NEWS STORY on drop.io & TheOldMan49's tweet.
-Basically talks about how MCV has been identified as missing & the fact that she is PJ's cousin. Also rehashes that police have 1 suspect in PJ's murder & that person is still JB.
Speaking of TheOldMan49, his recent tweet says:
TheOldMan49's tweet wrote:
Today's El International de Mexico has a troubling headline - are they just catching up with what we already know, or has MCV been taken?
MCV's Huracan > Targets > Bio states: Class=RED/Elusive, Threat=RED (previously Amber). WIth that, unless the page has not been updated, she has not been Engaged & / or captured yet.
el_international_de_mexico_-_20.pdf
Description 
pdf

 Download 
Filename  el_international_de_mexico_-_20.pdf 
Filesize  346.36KB 
Downloaded  276 Time(s) 
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Thu Mar 19, 2009 4:11 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Getting back to the conspiracy note that "Susannah St. John" posted on the wall in Josh's Habbo room:
Susannah's message to Josh wrote:
Josh im not sure about
theoldman49 i dont trust him, he
knows to much
please keep your self safe, for
arcadio,
the best of luck Susannah St John

P.S have u heard from Ixchel lately?

As I stated before, Im not worried about this yet because TheOldMan49 knows everything we know so far. The interesting part is I dont know if this is a player or the character from Ice Shock interacting here.
-Explanation from Ice Shock (very BIG story spoiler):
Spoiler (Rollover to View):
Josh receives post cards with ROT-23 ciphers directing him to go on a mission in Tlacotalpan to learn more about his dad's death. Josh & Ixchel then ditch Benicio & Montoyo and go on an unsanctioned mission to meet the person who sent the post cards. Through their collective cluey intelligence, they identify the person they are supposed to meet & that person is Sussanah St. John. Through talks with Sussanah, they find out that the postcards were sent by Sussanah, but written by a Mr. Arcadio Garcia.

Heres the deal: The package with the cards and delivery instructions were sent to Sussanah in 1965 with instructions to not open that or look at the contents until 1968. She waited the 3 years, opened up the parcel and noted the instructions told her to wait over 40 years to deliver the post cards to Josh (the cards were dated 40 years in advance to the day). She did as instructed. The instructions also stated that within the month (40 years later), Sussanah was to wait at the rendezvous point for Josh. This meeting occurred & from that point, Josh explains that the author of the post cards (Arcadio) is probably not his Grandfather due to incorrect name /description etc.

This part of the conversation evolves to the point that Josh thinks Arcadio may be from the future & may even be his son!!! IE: Time travel could be involved, and there is good reason to think time travel is the answer because of this bombshell (REAL SPOILER HERE): The IX codex (& other Mayan codices) were written around 350 BC. One other thing: The IX codex was originally written in the English language. The Ek Naab executive / sect could not translate this into Mayan until 1842 when they learned English from the writer John Loyd Stephens…
Btw, I have about 50 pages left in Ice Shock & the book is crazy. I have not read so much action and craziness for a very long time. Love the book Very Happy
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Fri Mar 20, 2009 6:16 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
ndemeter
Entrenched


Joined: 28 Jul 2004
Posts: 1037
Location: Sunny California!

Do you think it takes familiarity with the previous books to enjoy this one or is it good as a stand-alone?
_________________
Twitter: NickoDM - XBL: NickoDM

PostPosted: Sat Mar 21, 2009 9:12 pm
 View user's profile AIM Address Yahoo Messenger MSN Messenger
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

@ ndemeter: Having read both books, I can say the ARG is stand alone -at least up to the point I am at right now. The books are very cool but not necessary to join this as normal argish research & digging gets you everything you need to move forward. Based on that I believe the ARG is self contained and enjoyable without the books. ETA @ndemeter: I just read your question again and realized I probably didn't answer it. If you are strictly talking about the books, then heres my thoughts on that. You could read Ice Shock without having read Invisible City & you would probably find it very enjoyable. However, looking at this with retrospect, I would not take that route. Reason: Primarily because some characters are discussed in Ice Shock & the discussion is dependent on being introduced to and knowing the background of those characters as outlined in Invisible City (all secret locations / technology & characters introduced in bk1 are brought back in book 2 with minimal to zero rehash / allot of the info is understood). Also: Ice Shock starts out at a sprint pace XD, & real bad things happen to characters that will emotionally involve you to a much higher degree if you've read bk1.

Currently in the ARG: Gabi's blog has 4 more vids since last Fridays "Countdown" vid. Josh has gone offline / underground, so I think at this point it is up to the players to help Gabi and / or solve who killed her dad / figure out the conspircy etc.

With that stated: I think that some of the "Access Denied" pages on the Huracan files page may be made available soon (or already are & I havent figured that out yet). From that perspective, I think Gabi has caught up to my research and may be moving beyond what I have posted thus far.

In her recent video post "Ancient Sumerian", she talks about looking at the symbols on "The Adapter", listening to the convo between Melissa DiCanio & JB on the Huracan page, and reading the article on this IN GAME SITE. For reference, Im going to post my translit of "The Adapter" now.

Note on my translation: If you look at the link in the previous scentence, the anunnaki.jpg pic is strange to me because I see it as "AN.BU.NA.KI" from THIS TRANSLITERATED SUMER FONT
-search the page for "BU" & check out the symbol? Sumerian Typo or I am just stone cold wrong Dunno -btw, after typing the correct pw into the Runig page, the prompt button for the redirect spells it correctly (see the pic I posted on page one "LUGAL ANUNNAKI" for a comparison). Note on "BU": I think this is sumerian consonant -concatenation of 2 sign variants, but I cant tell if Im missing something here.

ETA from 25-MAR: I love it, just noticed the Huracan page has a new Adapter copy with the following correction:
Huracan>Erinsi Tech>The Adapter wrote:
Note: A fault was copied into the translation and has now been corrected.
- So forget "BU" above and the pic below as that has been corrected.
Adapter_firstside_Sumerian.jpeg
 Description   
 Filesize   22.8KB
 Viewed   133 Time(s)

Adapter_firstside_Sumerian.jpeg

_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Mon Mar 23, 2009 2:43 pm
Last edited by Psysop on Thu Mar 26, 2009 3:02 am; edited 1 time in total
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Jessica's family kidnapped / Gabi runs away
MCV article correlates to inscription on The Adapter

Gabi posted 2 more vids "Gone" & "Leaving". In "Gone" Gabi talks about how Jessica's entire family went out to a restaurant and have now been identified as missing / kidnapped (& Gabi was supposed to be with them but decided to not go).

In "Leaving" Gabi states she ran away from Jessica's house with her moms cash card & her dads Blackberry & cell so she can still update her v-blog via wireless access. She also talked to Runig (the Huracan site does not have this portal convo documented yet). -But Gabi pasted the following convo into her entry for this vid:
Gabi to Runig on Huracan Portal Chat wrote:
>>> What have you done with the Ortiz family?

You know what I want, Gabi Beltran. I want your father's research. All of it. Every sample of that DNA sequence. And the names of anyone who knows about it.

>>> The Ortiz family did nothing to you. They didn't even know about any of this. They were just trying to help me.

And look where your selfish escapade got them.

>>> If I do what you ask – will you let the Ortiz family go free?

That's negotiable. First I want you to hand yourself over. You and all those test-tubes.

>>> Leave me alone. I just want my life to be how it was.

You know that can't happen. Not now.

>>>I'm going to the police.

You may find it's too late for that.

>>>Too late?

You have three days, Miss Beltran. Three days to hand yourself over to me. Or you will never hear from the Ortiz family again.


Also From today: TheOldMan49 TWEETS explain that he is probably the admin & MCV was a contributer to THIS IG SITE. He states that the inscription on "The Adapter" rings a bell with this past article by MCV that he has re-uploaded to the site at THIS LOCATION.

ETA:
I think "rings a bell" from TheOldMan49 makes sense now for this reason: If you look at the Sumerian symbols I posted from the first side of "The Adapter" , and then group the symbols to what is stated in the article he references HERE (& other wiki references on amino's to fill in the blanks), you get the following (which appears to be the sequence / Runig's URL):

Adapter Row1:
DUB.SAG=A/ALANINE, LUGAL=G/LYCINE, AN=Y/TYROSINE, BU=L/LEUCINE, NA=I/ISOLEUCINE, KI=H/HISTIDINE, ME.LI.IM=R/ARGININE

Row2:
A2=PP/PROLINE X 2, IM (ME.LI.IM)=R/ARGININE, IGI.BA (IGI.LUL)=E/GLUTAMIC ACID, NA=I/ISOLEUCINE, TI.E=K/LYCINE, LUGAL=G/GLYCINE, ME.LI.IM=R/ARGININE

Through process of elimination I grouped the sequence on The Adapter in the following way (again from the explanation in the article. This grouping = 20 amino's):
• one group of six amino acids (known by modern biologists as 'aliphatic'):
LUGAL=G/GLYCINE, LUGAL=G/GLYCINE, AN=Y/TYROSINE, BU=L/LEUCINE, NA=I/ISOLEUCINE, KI=H/HISTIDINE
• two groups of three amino acids ('basic' and 'aromatic'):
ME.LI.IM=R/ARGININE x 2
• four groups of two amino acids ('acidic', 'hydroxlyic', 'amidic', 'sulphur-containing'):
DUB.SAG=A/ALANINE, IGI.BA (IGI.LUL)=E/GLUTAMIC ACID, TI.E=K/LYCINE, A2=P/PROLINE X 2

[SPEC] With that stated, umm I think that the other side of the adapter (which we have not seen yet) would explain this more. Explained by breaking down the Sumerian (for the time being), I can see the the url/sequence string is actually 20 amino acids and not 15? This is apparently English in a time travelly sort of way. My head hurts now...

ETA2:
"Surveillance" on The Huracan page was just updated with:
Gabi's PORTAL conversation with Runig (Thurs 24th -pasted above)
Dr. PJ Beltran>VOICEMAIL> audio clips "DiCanio Message 3" & "Beltran Message 4" uploaded.
Dr. Jackson Bennett>FACE TO FACE> audio clips "Recording CHQ-6LP-3" & "Recording CHQ-6LP-4" uploaded.

ETA3:
Getting anal here, after TheOldMan49 re-posted the above article he stated this on his most recent tweet:
TheOldMan49's recent tweet wrote:
Article online now. I remember now why we pulled it - many complaints from Sumerian experts that it was bogus! http://tr.im/sumeriancode

[SPEC]I think that we have a record of specific people debunking this stuff from the get go. Primarily talking about a previous spoil thread on page 1 "Backstory on Josh & a note about Simon Madison" that explains...
Spoiler (Rollover to View):
the Backlog of a fellow named Marius Marineau from Chaldexx. This guy was the first person Josh's dad contacted & he debunked Josh's dad telling him to not follow this route of interest. -Looking forward at what is now available on the Huracan page, go to Surveillance>Mary-Carmen Valencia & listen to the Phone Conversation "Martineau and Valencia". He debunks her to high heaven (Note: She is the co-author of the re-posted article in question). At this point I dont think I need to say why this interests me...

Note: From this point on, I will still be adding threads in this same format until the end game. But I will not directly state who I think PJ's killer is because I don't want to ruin the "Solve the mystery of THE DESCENDANT" CONTEST FOR THE KIDS IN EUROPE.


ETA4:
New IO.DROP news article. Basically states the cops think it is a normal Mexico kidnapping...
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Tue Mar 24, 2009 2:52 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

2 new vids from Gabi
Ice Shock spoilers that shed light on the Huracan Page etc...

Gabi posted new vid "Scared" on her V-BLOG . Basically confirms she is on the run, its too late to involve the cops & she left another message on Mary-Carmen's voicemail in the hopes that she is still accessing her answering machine. At this point Gabi thinks that MCV is the only person that can help her...

New vid "BlackBerry" also posted explaining that she turns it off after blogging to save the battery & also asks the question:
Gabi from BlackBerry wrote:
Turning off the blackberry stops me from being traced...Right?
[SPEC]-I think we will see some gps action in this very soon...

ETA (after the stuff below)
Gabi posted new vid "Mary Carmen!". MCV called PJ's blackberry & told Gabi that, yeah your in trouble & you know that, chill & Ill call you back with further instructions because we need to get you to safety...

ETA:
Summary on The Sect Of Huracan from Ice Shock. Note: I have attached the symbol for the Sect of Huracan below as a reference:
Spoiler (Rollover to View):
On a side mission, Josh took it upon himself to break into the house of a known Huracan Operator to steal email docs from a computer and noting the symbol on the header of the emails. After noting the emails and the symbol, Josh met with Montoyo in Ek Naab to discuss this event. He drew the symbol and was then told this by Montoyo (this is not exact):

This is the symbol/glyph that represents The Sect Of Huracan. They worshipped the Mayan storm god Huracan who was the bringer of the great flood in the mayan creation myth. We (Ek Naab maya) thought that sect was disbanded centuries ago because they were expelled from Ek Naab in the 17th century. They were the most dangerous death cult ever known. Huracan was the sect that engineered the collapse of the Mayan civilization...This news is very bad because it basically states that The Sect of Huracan is back! They are possibly the only people on the planet that would really enjoy witnessing the collapse of all civilization.


Summary of The Adapter, Revival Chambers & World Control when the "2012 Problem" occurs as referenced on the Huracan page (this explanation is basically how it is explained in Ice Shock):
Spoiler (Rollover to View):
Note: I do not know what exactly the Chambers do or how they work (yet). With that stated, I think when the chambers are activated they somehow manage to stop or allow the Users to control the negative effects of the "2012 problem". BIG 2012 spoiler (overly simplified heheh): From what I gather, a bunch of spacey / sciency type stuff goes down when all the planets align etc, radiating a huge electro magnetic pulse on the planet Earth -refered to as "the galactic superwave" (this in effect would blow out / shut down all electronic technology & render society in a state of Anarchy & all that encompasses that (collapse of civilization, mass extinction etc). Based on that, the Sect that has control of the Chamber tech has allot of leverage with what will occur when the Mayan long count calandar ends (2012 problem).

[SPEC] At the present time, there are technically 3 primary Shadow governments that have capability to utilize & high motivation to acquire the Erinsi technologies (the Revival Chambers & artefacts that activate the chambers): The Ek Naab (Sect/Population), Sect of Huracan & the NRO. With the caveat that Chaldexx may be a 4th "Sect" & / or is operating as a division of one of the primary 3 sects.


Summary of the Revival Chambers & activation components from Ice Shock:
Spoiler (Rollover to View):
- This is an exact quote from Ice Shock:
"Essential instructions on use of Revival Chambers. Three elements required. Key, Adapter and Container. All protected by bio-defense."

-With that stated, In Ice Shock an attempt (I think) & / or trial run to activate the Ek Naab chamber (by The SOH & not known by the Ek Naab sect) went down & this is the explanation on the above components (again this is not exact quotes):
The "Key" is attached to the "Adapter" which causes a chemical reaction changing the composition of the Adapters surface. At that point the Adapter is placed in the "Container" and the Revival Chamber is activated.

[SPEC] One of the Rot-23 messages that Josh got from a post card stated:
WHAT.KEY.HOLDS.BLOOD. (Note: The rot-23 is the first letter of each word/ solves to "THEY") - Based on that, I believe the message may contain a double meaning. And to me that says something to the effect: DNA is the key that holds blood. IE: A specific sequence of DNA is the Key that is applied to the surface of the Adapter.

Final Note on "The Erinsi": Erinsi translates from Sumerian to "people of the memory". Apparently the Erinsi wrote every one of the codices originally in Sumerian & translated into english by Itzamna (before the language was invented no less) and later translated to Mayan (the codices) by the Ek Naab Mayans. The Muwan craft, all artefacts, bio-defense and chamber technologies are of Erinsi design/construction etc.


Quirky side note that is not important:
A user "Trowgen" from the official forum stated in the "Spoil-arama" thread:
Trowgen wrote:
...you can use Psysop's very useful cipher key that I have NO idea how he worked out without Invisible City...

Heres how: Chapter excerpts gave me "YOUFOUNDME". I then placed those letters on THIS TEMPLATE KEY referencing what line (on the 3 line key they reside). That gave me letters from each line & the hint that each line was probably a third of the alphabet. I then rearranged the lines in the sequence from what I thought would logically be A - Z. I also noticed that there was a double space where the "N" was supposed to be & I knew this because I also knew what the symbol for "N" was. Then I looked at this MAYA LANGUAGE WIKI (Orthography section) & learned the backward "ɔ" is "C" as well. At that point I placed the C on my key, arranged the lines in proper order & shifted the "N" to the correct location, and there you go...
Sect_Of_Huracan_Glyphs.jpg
 Description   
 Filesize   83.36KB
 Viewed   120 Time(s)

Sect_Of_Huracan_Glyphs.jpg

_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Wed Mar 25, 2009 2:28 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Help Gabi to get to the rendezvous point to meet her Aunt!
& some other site updates etc...

The CHALDEXX page has a scrolling news ticker at the bottom that now states this:
Chaldexx Latest From the Greatest new ticker wrote:
URGENT ANNOUNCEMENT - Chaldexx CSO, Professor Melissa DiCanio reported missing in Middle East!


The following 2 new vids posted since my previous thread:
"One More Day" - Posted last night. Basically talks about Hans Runig being a killer & the fact that if Gabi doesnt report to him in one more day, Runig will kill the Ortiz family...Note: The time for her to report to Runig expires today heeheheheh

"We are go!" - Posted last night. Gabi recieves another phone message from MCV telling her to make her way to "Estadio Azteca". Once she gets there, MCV will meet her and they will drive off together.

Also: Dropped on Gabi's blog this morning:
Gabi Beltran wrote:
I think I've got this working...
It took my WAYYY longer than I expected…pah, it's always the same with programming.

But I DID it, yAy mE!!!!! Smile

I'm going to run for it. And here on
http://www.geekgrrlgabi.com/ you can see how I get along.

I'm leaving this place around 1am, Mexico City time. I'll try and post something right away…

aND yOu CaN hELp Me! sEE yOu thERe!

When you go to that link, you basically track Gabi by GPS (showing the tracking on Google maps). While tracking her movements, You hear audio of Gabi talking to you. When Gabi gets to points where she needs to make a descision, you are prompted to answer questions in the attempt to help her out. This interactive part takes approximately 40 mins to complete -& yes you can stop & start at your own leisure & it wont mess anything up Smile. So without further ado, I'm going to post my answers and the outcome. Note: I only did this once, so I don't know what happens (if anything) if you don't answer the way I did:
Spoiler (Rollover to View):
It starts out with Gabi walking on foot, she knows she needs to get to the Stadium & plans on taking a train to get there. Then she asks you to help her find what trainline she needs to take to get to the stadium. A quick Google search of the stadium got me these links I referenced:
http://en.wikipedia.org/wiki/Estadio_Azteca
http://en.wikipedia.org/wiki/Xochimilco_Light_Rail
(click the image to count the stops on the Xochimilco line)

Q: What train line do I take?
A: Xochimilco

Gabi then talks about how it looks like someone is following her, at this point she basically asks you if she should continue walking & see what happens, or should she run through a park in the attempt to ditch the dude that is following her...

Q: Should I run or not?
A: RUN

She then runs and loses the dude! She starts walking to Quevedo (street) & catches a bus that drives her to Tasquena train station. She gets to the train station & talks about how scared she is because she saw a black Ford Explorer Wink
She then asks:

Q: How many stops on the train?
A: 17 stops (I counted the stops HERE )

Then on the train, she sees 2 Black Explorers following her train. She thinks they are going to jump on the train at the next stop!!!
She then notes that 1 explorer was waiting at the stop, & 1 drives ahead of the train to the next station/stop.
Then Gabi talks about how she now does not know if she can trust her Aunt etc.

Q: Should I trust her YES / NO ?
A: YES

Then Gabi basically asks you if you think she should just stay on the train, or if she should get out at one of the stops.

Q: Should I stay or get off the train?
A: Stay

staying on the train she sees a dude with an ankle length trench coat get on and go to the back of the car...She is frightened at this point, but glad she stayed on the train.
Then she talks about how she realizes MCV is trustworthy as she could have captured Gabi or just told Runig from the start... But then Gabi starts talking about how she thinks she is taking Runig & his operators (in the Explorers) straight to MCV & the rendezvous point where they will both be captured! She is basically terrified at this thought...

Q: What should I do, stay or go?
A: (again, I say) STAY

Gaby is now running & talking, she bailed the train by pulling the freakin brake because the dude in back (with the trench coat) broke out a gun and leveled it at her, she pulls the train emergency brake and the dudes shot misses her head, shattering the window next to her. She jumps off the train and runs like a bat out of hell...
During this time, people are shooting at her chasing her, 1 of the Explorers pulls over & dudes with guns get out to chase her as well. she hasnt seen the other truck yet, shes running and can now see the enemy agents spreading out to get her! Shes trippin hard at this point & generally freaking out running around the parking lot and the side of the Stadium in the hopes that MCV will spot her!!!

Q: Should I go LEFT or RIGHT?
A: Right

She goes right & OMGZ, The 2nd explorer is rolling up! She is now being heavily chased & is screaming for help!!!!!!!

The car spins around & then out of no where MCV smashes her car (t-bones) into the Explorer!!! gabi starts screaming that shes on the wrong side because shes under allot of heat & being heavily pursued etc. She screams that she can see MCV's blue cherokee again, but she doesnt see Runigs dudes (the enemy operators) anymore. Then she starts pannicking again, screaming that she now sees the 2nd Explorer rolling up now. She is tripping balls & cant think straight, so she asks you

Q: Should I go to the WHITE, BLUE, or RED car?
A: BLUE

Gabi starts towards MCV's blue cherokee & then OMGZ! They ram MCV's car, huge wreck, Gabi screams for MCV to bail the car wreck and run to her! (this scene / audio is just mayhem hehehe)
With MCV now, they both circle back to the first car that RUnigs dudes left. They jump in & steal the car. They floor it outta there (sounds like they are redlining that bad boy heheheheeh smoking tires to get the hell outta dodge)

While they are driving away Gabi tell you that they are going to Cuernavaca to catch a plane that JB setup. She thanks you for helping and remaining so calm, giving her answers etc.

_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Fri Mar 27, 2009 4:14 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Gabi escapes with MCV & they meet up with JB
& they request info & / or the name of PJ's Murderer...

So Gabi escaped with MCV. They took a plane out of Mexico & met up with JB. They currently do not know where they are going to settle down, and will probably be on the run for quite a while. Currently Gabi wants people to submit information & / or the name of the person that had PJ murdered (the contest / end game). Check Gabi's BLOG ENTRY to submit information on who killed her dad:
Gabi's We Made it! blog post summary wrote:
But…still no-one is really sure who killed my father.

If you've been following this blog - and I know someone has (I checked my blog stats Razz) – then maybe you can help?

Send me an email at beltran_gabi (at) yahoo.com and post your information there. If you email me I pROmISe I'll get back to you...eventually...and let you know how it all worked out.

With that stated: Two recent IO.DROP NEWS articles submitted. "26" basically states that Gabi is missing & the police have connected that to JB, MCV & the Ortiz family kidnapping. News article "28" is summarized as follows:
El International de Mexico - 28 wrote:
Originally Posted by El International de Mexico - Summary
Biotech scientist reported missing in Middle East yacht mystery.


Doha, Qatar: UK-based University neuroscience Professor and biotech entrepreneur Professor Melissa DiCanio was declared missing late yesterday by Qatar officials after fishermen discovered her empty yacht and raised the alarm.

Colleagues at DiCanio's company, Chaldexx BioPharmaceuticals have expressed anxiety. Chaldexx CEO Michael Carter commented: "Melissa is part of a family here at Chaldexx. We hope she will return to us soon."

At this point I would like to note TheOldMan49's LATEST TWEET that states:
TheOldMan49's Tweet wrote:
Gabi's trauma finally over...yet the mystery remains. Who killed Gabi's father, Dr Beltran? Feel sure the final clue at http://chaldexx.com

Based on that, if you go to the CHALDEXX SITE, you will see the following updates:
Chaldexx>Family>Remark under the header states:
Chaldexx Family link note wrote:
Samantha, can you please insert some Chaldexx corporate bull here... the usual lovey-dovey blah blah blah. Thanks! See you for coffee tomorrow? M.

Then Chaldexx>Family>Professor DiCanio (image) remark states:
Signed by Ninhursag wrote:
Professor Melissa DiCanio in better days, leading the Chaldexx ski team to victory on the slopes.

Regarding the recent, worrying events, all we know so far is that Melissa has been reported missing since she left Doha Harbour in a yacht. We'll keep the Chaldexx family posted about any further developments.

Our thoughts are with Melissa's family in this time of tremendous anxiety.

Submitted by: ninhursag

And Chaldexx>Investor Relations now states:
Chaldexx Investor Relations wrote:
OFFICIAL STATEMENT CONCERNING DISAPPEARANCE OF PROFESSOR MELISSA DICANIO

27th March

The Board of Chaldexx BioPharmaceuticals wishes to reassure our investors that the unfortunate disappearance of Professor DiCanio will not slow the company's progress.

We are deeply concerned for Melissa and will be doing everything we can to help police in Qatar trace her movements in the days before she went missing. However, Melissa has a strong and capable team who will continue with their research at full pace until this stressful time is over.

Andrew Browning, head of Strategy Planning told me "Slack off? We wouldn't dream of it. Melissa means too much to us. When she returns to Chaldexx, we're looking forward to showing her the amazing progress we've made."

Steady words from our colleague there!

Michael Carter, CEO

I think that is all... I'm going to submit a name to Gabi tonight or tomorrow. But at this point, my argish mind has me slightly confused & I'm running about 4 different scenarios on who the actual murderer is...Im just going to give it a shot Wink
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Sun Mar 29, 2009 3:38 am
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Waiting for endgame response from Gabi
also: virtual wrap party is in the mix in the near future...

I sent off my suspect to Gabi's email today (but I do not expect to win anything as the contest is for the kids in Europe, I just need closure hehehe to see if my suspect is correct etc). -After the Contest is won I will post the results here for archival purpose.

Note: Post ARG virtual wrap up party is going down at some point in the near future Smile, check out MG's BLOG ENTRY. On that same link is a "Help MG decide where to hold the ARG virtual wrap party?" poll. Note: I voted for it to be on Mogulus, as I think that Habbo may be confusing waiting for the text to scroll etc. Also, I want to see the people involved & Mog is audio, video & text chat Wink
_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Mon Mar 30, 2009 6:15 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Psysop
Decorated


Joined: 26 Sep 2008
Posts: 270
Location: San Diego, California

Post ARG meeting in Habbo Saturday April 4th

I got my endgame response from Gabi (my suspect theory was correct) & I will post that when the contest is won.
Post ARG wrap up email wrote:
MG Harris and Richard Howse, authors and developers of THE DESCENDANT Alternate Reality Game will be chatting with ARG players and Joshua Files fans.

(The location was chosen by a poll on mgharris.net)

When: Saturday 4th April at 1730 London UK time.

Where: Habbo Hotel , MariposaJosh's room

http://www.habbo.co.uk/

See you in Habbo!

_________________
Playing:Who knows...
lrk: all
I know what dude I am. I'm the dude playin' the dude, disguised as another dude!


PostPosted: Fri Apr 03, 2009 7:05 pm
 View user's profile Visit poster's website
 ICQ Number 
 Back to top 
Display posts from previous:   Sort by:   
Page 2 of 2 [29 Posts]   Goto page: Previous 1, 2
View previous topicView next topic
 Forum index » Archive » Archive: General » Old News & Rumors
Jump to:  

You cannot post new topics in this forum
You cannot reply to topics in this forum
You cannot edit your posts in this forum
You cannot delete your posts in this forum
You cannot vote in polls in this forum
You cannot attach files in this forum
You can download files in this forum
You cannot post calendar events in this forum



Powered by phpBB © 2001, 2005 phpBB Group